dissabte, 11 de setembre de 2021

La comunicació felina, la flora bacteriana dels xiclets i l’obesitat dels polític: Premis Ig Nobel 2021

Aquest dijous s’ha realitzat la cerimònia, virtual, de lliurament dels Premis Ig Nobel 2021. És la segona vegada que la cerimònia té un caràcter virtual. Arribats a la 31a edició, els Premis Ig Nobel ens fan riure (i pensar) sobre la recerca, la societat i la natura.

La comunicació gat-humà (Susanne Schötz, Premi Ig Nobel de Biologia)

Susanne Schötz ha rebut el Premi Ig Nobel “per analitzar variacions en ronroneus, xiscles, xerrameques, trillades, maullades, laments, xiulets, udols, grunyits i altres modes de comunicació gat-humà”.

En efecte, Schötz combina dos dels seus interessos favorits, els gats i la fonètica, en aquesta línia de recerca. Així doncs, en el 2011, en la Conferència Fonetik d’Estocolm, presentava amb Robert Enklund, una anàlisi acústica comparativa del ronroneu de quatre gats. En l’edició següent, presentava en solitari un estudi pilot de la fonètica de vocalitzacions de tres gats. En l’edició del 2013 de la mateixa conferència, aprofundia en l’estudi fonètic de diferents tipus de vocalitzacions d’aquests tres gats. En el 2014, en el marc de la 7ª Conferència Internacional de Prosòdia de la Parla, presentava amb Joost van de Wejter, un estudi sobre la percepció humana de l’entonació de miols de gats domèstics. En la Fonetik 2016, amb Eklund i Van de Weijer, resumien les aportacions del projecte Meowsic, dedicat a estudiar la melodia en la comunicació humà-gat.

La fonòloga Schötz recollí el premi en la cerimònia virtual de dijous.

El bacterioma dels xiclets mastegats (Leila Satari, Alba Guillén, Àngela Vidal-Verdú, Manuel Porcar; Premi Ig Nobel d’Ecologia)

Leila Satari, Alba Guillén, Àngela Vidal-Verdú i Manuel Porcar han rebut el Premi Ig Nobel d’Ecologia “per emprar l’anàlisi genètica per a identificar les diferències espècies de bacteris que resideixen en les pasterades de xiclet mastegat enganxades en els paviments de diversos països”.

En efecte, aquests investigadors de l’Institut de Biologia Integrativa de Sistemes (I2SysBio) de la Universitat de València i del CSIC, amb seu a Paterna, recolliren xiclets enganxats en el paviment que envolta el Parc Científic de la Universitat de València, així com a localitzacions de París (inclòs Eurodisney), les Σπέτσες, Istanbul i Singapur. A més, seguiren l’evolució del bacterioma durant tres mesos d’exposició a l’ambient extern de xiclets mastegats. D’aquests espècimens establiren una col·lecció de soques bacterianes, en les que estudiaren la capacitat de biodegradació de diferents ingredients dels xiclets. En un article a Scientific Reports constataven que la microbiota oral (Streptococcus spp, Corynebacterium spp.) present en els xiclets mastegats es veu desplaçada en qüestió de setmanes per una microbiota ambiental (Acinetobacter spp., Sphingomonas spp., Pseudomonas spp.). Pel que fa als xiclets de diferents localitats del món comparteixen un bacterioma semblant (Sphingomonas, Kocuria, Deinococcus, Blastococcus) però diferenciable.

La recerca de Satari et al. pot semblar un poca-soltada, i per això els han donat el Premi Ig Nobel, però el cert és que el coneixement del bacterioma dels xiclets té aplicacions en medicina forense. Ells també pensaven en la utilització en el monitoratge de malalties contagioses. Finalment, els microorganismes d’aquest ambient poden tenir aplicacions en el tractament de residus.

Satari, Guillén, Vidal-Verdú i Porcar eren presents en la cerimònia virtual on reberen el guardó.

L’olor de la por en les sales de cinema (Jörg Wicker, Nicolas Krauter, Bettina Derstroff, Christof Stönner, Efstratios Bourtsoukidis, Achim Edtbauer, Jochen Wulf, Thomas Klüpfel, Stefan Kramer, Jonathan Williams; Premi Ig Nobel de Química)

Jörg Wicker, Nicolas Krauter, Bettina Derstroff, Christof Stönner, Efstratios Bourtsoukidis, Achim Edtbauer, Jochen Wulf, Thomas Klüpfel, Stefan Kramer, i Jonathan Williams han rebut el Premi Ig Nobel de Química “per analitzar química l’aire dins de sales de cinema per comprovar si les olors produïdes per una audiència indiquen fiablement els nivell de violència, sexe, comportament antisocial, ús de drogues i llenguatge groller en la pel·lícula que veu l’audiència”.

L’agost del 2015, Jörg Wicker, Nicolas Krauter, Bettina Derstoff, Christof Stönner, Efstratios Bourtsoukidi, Thomas Klüpfel, Jonathan Williams i Stefan Kramer presentaren una comunicació en la Conferència Internacional SIGKDD sobre Descoberta de Coneixement i Mineria de Dades en la que proposaven l’ús de l’exhalació de compostos orgànics volàtils (VOCs) en el monitoratge de la resposta humana a estímuls emocionals. Aquests VOCs es poden detectar en l’aire que envolta aquests subjectes. Wicker et al. prenien com a espai experimental una sala de cinema, amb la intenció de comprovar la relació entre el perfil de VOCs i el contingut semàntic de la pel·lícula projectada. Ho van fer durant un mes, prenent dades de VOCs en intervals de 30 segons, i casant-les amb el contingut del film projectat. Construïren models de predicció i de causalitat, constantant que és possible fer-ne prediccions de baix error basades en una relació causal.

Corbes de predicció per a dos films, un per a tots els públics (“Help I’ve shrunk my teacher”) i un per a major de 12 anys (“I’m off then”).

Stönner, Achim Edtbauer, Destroff, Bourtskoukidis, Klüpfel, Wicker i Williams publicaven en octubre del 2018 un article a PLoS One amb la prova de concepte sobre un mètode de classificació de films per edat d’acord amb els compostos orgànics volàtils humans emesos en projeccions en sales de cinema. La majoria dels compostos no eren capaços de predir tots els factors que entren en la classificació d’edat (aparicions de violència, sexe, comportament antisocial, ús de drogues, llenguatge barroer). Això es deuria al fet que aquests compostos, emesos en l’alè i a través de la pell, s’associen més aviat a respostes biològiques viscerals una mica més senzilles. No obstant, Stönner et al. constataven que l’isoprè si era un bon predictor de la classificació de films per edat, segurament perquè l’emissió es relaciona amb nivells d’agitació muscular.

Wicker, Krauter, Derstroff, Stönner, Bourtsoukidis, Edtbauer, Wulf, Klüpfel, Kramer i Williams recolliren el guardó en la cerimònia virtual.

Obesitat de polítics i corrupció post-soviètica (Pavlo Blavastkyy, Premi Ig Nobel d’Economia)

Pavlo Blavatskyy ha rebut el Premi Ig Nobel d’Economia “per descobrir que l’obesitat dels polítics d’un país pot ser un bon indicador de la corrupció d’aquell país”.

Blavatskyy és professor titular del Departament de Gestió de Desenvolupament Sostenible de l’Escola de Negocis Montpelhièr. Enguany apareixia un article seu a la revista Economic of Transition and Institutional Change en el que es recolliren 299 imatges frontals del 2017 de ministres dels 15 estats post-soviètics. Amb aquestes imatges es feina una estimació per algoritme del seu índex de massa corporal. La mediana de l’índex de massa corporal dels ministres d’un país presenta una alta correlació amb mesures convencionals de corrupció (les de Transparency International, el Banc Mundial, l’Index of Public Integrity). Ministres grossos, país corrupte.

L’Estònia de la primera ministra Kaja Kallas és l’estat post-soviètic amb millor puntuació de transparència segons el Transparency Index

Blavatskyy recollia en la cerimònia de dijous aquest guardó.

Activitat sexual i descongestió nasal (Olcay Cem Bulut, Dare Oladokun, Burkard Lippert, Ralph Hohenberger; Premi Ig Nobel de Medicina)

Olcay Cem Bulut, Dare Oladokun, Burkard Lippert i Ralph Hohenberger han rebut el Premi Ig Nobel de Medicina “per demostrar que els orgasmes sexuals poden ésser tan efectius com les medicines descongestives en la millora de la respiració nasal”.

Bulut et al. abordaven aquesta qüestió en un article aparegut el mes de juliol en Ear, Nose & Throat Journal. Per tal d’avaluar l’impacte de l’activitat sexual en la respiració nasal, feien una avaluació d’aquesta respiració en cinc moments diferents: 1) abans de l’activitat sexual; 2) immediatament després de l’activitat sexual; 3) a 30 minuts de l’activitat sexual; 4) a 1 hora; 5) a 3 hores. Es feien les mateixes mesures l’endemà després de l’aplicació d’un esprai descongestiu. L’avaluació de la respiració nasal es feia amb un escala anàloga visual i un dispositiu rinomètric portàtil. En l’estudi, realitzat en el 2020, participaren 18 parelles heterosexuals, tots elles formades per treballadors sanitaris o parelles de treballadors sanitaris.

Després de l’activitat sexual, la respiració nasal millorava de manera semblant a administrar-se un esprai nasal. Val a dir, però, que l’efecte del descongestiu nasal perdurava més en el temps. De tota manera, els participants amb obstrucció nasal mostraven una millora de la funció després de l’activitat sexual

Bulut, Oladokun i Hohenberger recolliren el dijous el guardó corresponent.

Barbes contra colps de puny (Ethan Beseris, Steven Naleway, David Carrier; Premi Ig Nobel de Pau)

Ethan Beseris, Steven Naleway i David Carrier han rebut el Premi Ig Nobel de la Pau “per comprovar la hipòtesi que els humans desenvoluparen barbes per protegir-se de colps de puny a la cara”.

Els tres investigadors de Utah són autors d’un article a Integrative Organismal Biology sobre aquesta hipòtesi pugilística del véll facial humà. Aquest és un dels trets que presenta major dimorfisme sexual en Homo sapiens: bigoti i barba han estat percebuts com a indicadors de masculinitat i de domini social, fins el punt que hom ha comparat la barba humana amb la melena del lleó. En tots dos casos, l’excés de pèl ajuda a protegir àrees vitals com la gola i la mandíbula. És simptomàtic, a parer dels autors, que la mandíbula sigui un dels ossos més habitualment fracturats en violència interpersonal. Per tot plegat, hipotetitzen que les barbes protegeixen la pell i els ossos del rostre quan els mascles humans lluiten: la barba ajuda a absorbir i dispersar l’energia d’un impacte directe. En el seu article ens expliquen com comprovaren la seva hipòtesi amb un model de fibra d’epoxi (com a anàleg de l’os), damunt de la qual disposen pell ovina dissecada, que és coberta amb una capa densa de pèl o descoberta: sobre aquest sistema deixen caure un pes i mesuren la força amb una cèl·lula de càrrega. Sense la protecció d’aquesta barba artificial, el sistema rep un 16% més força i absorbeix un 37% d’energia total.

El model experimental de la hipòtesi pugilística

Beseris, Naleway i Carrier participaren en la cerimònia virtual per recollir el guardó.

Com s’eviten les col·lisions de vianants? (Alessandro Corbetta, Jasper Meeusen, Chung-min Lee, Roberto Benzi, Federico Toschi; Premi Ig Nobel de Física)

Alessandro Corbetta, Jasper Meeusen, Chung-min Lee, Roberto Benzi i Federico Toschi han rebut el Premi Ig Nobel de Física “per realitzar experiments per a entendre per què els vianants no col·lideixen constantment amb altres vianants”.

Corbetta et al. publicaven el 2018 un article a Physical Review E en el que modelitzaven interaccions entre vianants. El model es basava en observacions durant sis mesos d’usuaris d’una andana de tren i de les interaccions vianant-vianant que en resulten. L’article, doncs, és anterior a la pandèmia, però ja en aquella època els vianants, en el decurs del seu pas, adaptant el ritme i direcció de les passes per preservar una distància mútua de confort i evitar col·lisions. El model resultant reprodueix la prevenció de col·lisions binàries, tant pel que fa a l’abast llarg, basat en informació visual, com a l’abast curt, basat en el contacte directe.

Els cinc co-autors recollien el dijous el guardó en la cerimònia virtual.

L’autoorganització de les gentades (Hisashi Murakami, Claudio Feliciani, Yuta Nishiyama, Katsuhiro Nishinari; Premi Ig Nobel de Cinètica)

Hishashi Murakami, Claudio Feliciani, Yuta Nishiyama i Katsuhiro Nishinani han rebut el Premi Ig Nobel de Cinètica “per realitzar experiments per a aprendre per què els vianants de vegades col·lideixen amb altres vianants”. És a dir, que el premi fa parella antagònica amb l’anterior.

Murakami et al. publicaven ja en temps pandèmics un article a Science Advances sobre com l’anticipació mútua pot contribuir a l’autoorganització de multituds humanes. En aquesta recerca mostraven el vincle entre l’anticipació individual i l’emergència de patrons. Per exemple, en fluxos bidireccionals de vianants es generen espontàniament fileres unidireccionals. En els seus experiments, Murakami et al. mostren com distraccions visuals, en interferir en la capacitat d’anticipació d’alguns vianants, condueixen a un endarreriment en la formació de patrons col·lectius: en aquestes condicions tant els vianants distrets com els que no tenen dificultats per evitar col·lisions. D’això, Murakami et al. dedueixen que les maniobres d’evitació són normalment un procés cooperatiu, i que l’anticipació mútua entre vianants facilitar una formació eficient de patrons.

En els seus experiments, Murakami et al. utilitzen un corredor de 10 metres de llarg i 3 d’ample. Els cercles blaus indiquen vianants als qui s’assigna una tasca visual que els distreu.

Els quatre coautors de l’estudi recollien el guardó en la cerimònia virtual.

Control de paneroles en submarins (John Mulrennan, Jr., Roger Grothaus, Charles Hammond, Jay Lamdin; Premi Ig Nobel d’Entomologia)

John Mulrennan Jr, Roger Grothaus, Charles Hammond i Jay Lamdin han rebut el Premi Ig Nobel d’Entomologia per un estudi realitzat fa 50 anys sobre un mètode de control de paneroles en submarins.

Mulrennan et al. publicaven el 15 d’octubre del 1971 un article al Journal of Economic Entomology sobre un mètode de control d’aquesta plaga en naus submarines. Concretament, vuit submarins foren tractats amb un aerosol del 6,5% de diclorvos, a un ritme de 12 onzes per cada 10.000 peus cúbics. Tres dels vuit submarins, addicionalment, foren tractats amb un esquer de propoxur. El diclorvos mostrava un efectivitat del 97% en el control de paneroles. El propoxur s’adreçava al control de nimfes que haguessin eclosionat d’ous no afectats pel diclorvos. Els investigadors també prengueren mostres de l’aire dels submarins per avaluar la concentració de diclorvos abans i després de la ventilació.

Recentment, l’USS Connecticut ha estat víctima d’una plaga de xinxes. El control de plagues en submarins té un repte en la ventilació després de l’aplicació dels insecticides.

Després de cinc dècades, els tractaments de desinsectació de submarins han evolucionat, sempre mantenint l’equilibri entre l’eficàcia insecticida i la seguretat per a la tripulació. En tot cas, el dijous Mulrennan recollí el guardó en la cerimònia virtual.

El transport aeri de rinoceronts negres (Robin Radcliffe, Mark Jago, Peter Morkel, Estelle Morkel, Pierre du Preez, Piet Beytell, Birgit Kotting, Bakker Manuel, Jan Hendrik du Preez, Michele Miller, Julia Felippe, Stephen Parry, Robin Gleed; Premi Ig Nobel de Transport)

Robin Radcliffe, Mark Jago, Peter Morkel, Estelle Morkel, Pierre du Preez, Piet Beytell, Birgit Kotting, Bakker Manuel, Jan Hendrik du Preez, Michele Miller, Julia Felippe, Stephen Parry i Robin Gleed han rebut el Premi Ig Nobel de Transport “per determinar experimentalment si és més segur transportar per aire rinoceronts de cap per avall”.

Radcliffe et al. publicaven fa uns mesos al Journal of Wildlife Diseases un article sobre els efectes pulmonars i metabòlics de la suspensió pels peus, en comparació amb la recumbència lateral, en el transport de rinoceronts negres immobilitzats capturats per dards aeris. Els programes de conservació del rinoceront negre (Diceros bicornis) han requerit la captura d’exemplars vius i el seu transport per via aèria. Per fer-ho, degudament anestesiats, són lligats pels peus a un helicòpter i transportats cap per avall. La imatge és espectacular, i és raonable que hom pensi que això pot tindre conseqüències negatives en comparació amb un transport amb el rinoceront tombat lateralment. A més, un tractament amb etorfina pot conduir a un hipermetabolisme, amb un requeriment superior de consum d’oxigen i una major producció de diòxid de carboni. Radcliffe et al. forneixen dades corresponents a dotze rinoceronts negres, nou mascles i tres femelles, d’edats entre 8 i 25 anys, i masses corporals de 804 a 1234 kg. Aquests animals foren immobilitzats per dard aeri amb etorfina i azaperona. Se’ls suspenia bé en posició lateral (6 individus) o agafats pels peus (6 individus) des d’una grua durant 10 minuts, i llavors es prenien mesures metabòliques i respiratòries. Tots els animals desenvolupament hipòxia i hipercàpnia. Així doncs, les dues formes de suspensió tenen efectes fisiològics semblants, i fins a cert punt de menys impacte en el cas del transport cap per avall.

Morkel, Jago, Gleed i Radcliffe participaren en la cerimònia de lliurament del guardó.

diumenge, 5 de setembre de 2021

El Congrés de la Unió Internacional per a la Conservació de la Natura (IUCN) a Marselha

Aquesta setmana, del dia 3 a l’11, Marselha acull el Congrés Mundial de Conservació de la Natura de l’IUCN. Durant aquests vuit dies, més de 1000 participants es trobaran en més de 1300 sessions interactives, i decidiran sobre les més de 100 mocions que s’hi han presentat.

El Congrés acull, en primer terme, l’Assemblea de Membres de la IUCN. Són més de 1300 les organitzacions governamentals, de la societat civil i dels pobles indígenes les que hi participen. Tenen veu i vot sobre qüestions de conservació i de desenvolupament sostenible.

En segon terme, acull el Fòrum, considerat una àgora de coneixement per a la ciència, pràctica i innovació de la conservació i el desenvolupament sostenible. Al Pavelló Chanot de Marselha hi ha programades 600 sessions sobre aspectes econòmics, socials, científics i tècnics de temes que abasten la flora, la fauna, els oceans, les àrees protegides, l’economia sostenible, el canvi climàtic o els drets humans.

En tercer terme, és també una Fira de Mostres, amb pavellons i actes públics.

La pandèmia de covid-19 ha fet que el Congrés Mundial de la IUCN s’endarrerís un any. El nombre de participants a Marselha és deu vegades inferior al del Congrés anterior, celebrat a Hawaii el 2016.

Un dels aspectes més coneguts de la IUCN és la llista vermella d'espècies amenaçades. La Llista Vermella inclou a hores d'ara 138.374 espècies amenaçades, de les quals 38.543 es troben en perill d'extinció. La Llista inclou diferents nivells d'amenaçada, i val a dir que normalment les reclassificacions es fan de mal en pitjor. Una excepció de la revisió de la Llista fou comentada ahir per Bruno Oberle, director general de la IUCN: quatre espècies de tonyina ha millorat de perspectiva gràcies a mesures com a quotes de pesca o el combat contra la pesca furtiva. Així, Thunnus thynnus ha passat d'espècie en perill a espècie de menor preocupació; Thunnus maccoyii ha passat de en perill crític a perill simple; i Thunnus alalunga i Thunnus albacares de gairebé amenaçades a menor preocupació.

Un dels reptes de la Llista IUCN és que sigui ben exhaustiva, la qual cosa demana un millor coneixement de les poblacions. Per exemple, la revisió de la Llista IUCN calcula que el 37% de les espècies de condroicits (taurons i rajades) són en perill d'extinció. Les causes d'això són la sobrepesca (100% de les espècies amenaçades), la pèrdua d'hàbitats (31% de les espècies amenaçades) i el canvi climàtic (10% de les espècies amenaçades).

Com s'ha dit, la majoria de revisions de la IUCN van cap a categories pitjors. Així Varanus komodoensis ha passat d'espècie vulnerable a espècie en perill. Les raons d'aquesta reclassificació es relacionen amb l'impacte el canvi climàtic sobre el Parc Nacional de Komodo i de l'illa de Flores: l'ascens del nivell del mar reduiria en un 30% l'hàbitat del drac de Komodo en els propers 45 anys. Altres factors, a més, reduirien addicionalment els hàbits de Flores.

dilluns, 9 d’agost de 2021

La base física del Sisè Report de Valoració Panell Intergovernamental sobre Canvi Climàtic

El Panell Intergovernamental sobre Canvi Climàtic (IPCC) es troba en el procés d’elaboració del Sisè Report de Valoració (AR6), del qual avui s’ha presentat l’aportació del Primer Grup de Treball, corresponent a la base de ciència física. Aquesta contribució vol presentar quina és la comprensió física actual del sistema climàtic i del canvi climàtic, combinant els avenços realitzats en climatologia amb les evidències paleoclimàtiques, les observacions actuals i les simulacions climàtiques globals i regionals. Aquesta aportació ha estat aprovada en la 14ª Sessió del Primer Grup de Treball i la 54ª Sessió de l’IPCC que s’han celebrat aquests dies a Ginebra.

L’estat actual del clima

El report considera inequívoc que la influència humana ha escalfat l’atmosfera, l’oceà i la terra, alhora que canvis amplis i ràpids han tingut lloc en l’atmosfera, l’oceà, la criosfera i la biosfera. L’augment observat en les concentracions de gasos d’efecte hivernacle des de mitjan segle XVIII és causat inequívocament per activitats humanes. En el decurs de la darrera dècada s’han arribat a mitjanes anuals de 410 ppm per al diòxid de carboni (CO2), de 1,866 ppm per al metà (CH4) i de 0,332 ppm per l’òxid nitrós (N2O). Terra i oceà han absorbit vora un 56% de les emissions antropogèniques anuals de CO2 en el decurs de les darreres sis dècades.

L’escalfament es manifesta en el fet que les dues primeres dècades del segle XX han estat, en termes de temperatura superficial global, 0,99 K per damunt del nivell de la segona meitat del segle XIX. Les temperatures continentals han augmentat més que les oceàniques. Aquest escalfament és mediat per les emissions antropogèniques de gasos d’efecte hivernacle, davant del qual l’efecte de refredament dels aerosols antropogènics és menystenible, i encara més ho són les causes naturals de variabilitat climàtica.

El report també constata que és probable que la precipitació sobre els continents ha augmentat des del 1950, i de manera accelerada des els anys 1980. Els cursos de les tempestes de latituds mitjanes s’han desplaçat en direcció cap als pols.

El report considera que és molt probable que la influència humana sigui el principal motor de la retirada global de glaceres des dels anys 1990.

Les emissions antropogèniques de CO2 són el principal motor de l’actual acidificació global de les capes superficials de l’oceà obert.

L’escala dels canvis recents en el sistema climàtic en general no tenen precedents en els darrers segles o mil·lennis. Així doncs, els nivells atmosfèrics de CO2 són els més alts dels darrers 2 milions d’anys. L’augment de la temperatura superficial global en els darrers 50 anys ha estat el més ràpid dels darrers dos mil·lennis. L’augment del nivell global del mar és el més elevat dels darrers 3000 anys.

El canvi climàtic antropogènic ja afecta totes les regions del planeta en termes d’extrems meteorològics: ones de calor, fortes precipitacions, sequeres, ciclons tropicals, etc. En general, els extrems càlids s’han fet més freqüents des del 1950, mentre que els extrems freds han vist reduïda la freqüència i la severitat.

Possibles climes de futur

El report contempla cinc escenaris d’emissions d’efecte hivernacle, i els seus resultats a curt termini (2021-2040), mig termini (2041-2060) i llarg termini (2081-2100).

En tots els escenaris contemplats, l’augment de la temperatura superficial global es manté fins a mitjan segle XXI. Si no hi ha una reducció profunda en les emissions de gasos d’efecte hivernacle, l’escalfament global en el curs del segle XXI depassaria el valor de 1,5 K i fins i tot el del 2 K. En l’escenari pitjor, SSP5-8,5, l’escalfament global a final del segle XXI seria de 4,4 K respecte dels valors preindustrials.

El canvi climàtic s’associa amb una intensificació del cicle global de l’aigua, que guanyaria en variabilitat i es manifestaria en una major freqüències d’esdeveniments meteorològics extrems.

Fins i tot si l’escalfament antropogènic es limités a 1,5 K, el nivell global de la mar pujaria de 2-3 metres durant els propers 2000 anys.

L’adaptació al canvi climàtic

En fer planificacions regionals cal entendre l’efecte modulador de factors naturals i de la variabilitat interna sobre els canvis climàtics antropogènics. De tota manera, el report contempla una intensificació de precipitacions extremes i de sequeres. Afebliments de circulacions oceàniques podrien amplificar l’impacte del canvi climàtic global a escala regional.

La mitigació del canvi climàtic

La mitigació de l’escalfament global exigiria arribar a una situació d’emissió neta zero de CO2 i de forta reducció de les emissions altres gasos d’efecte hivernacle.

El report també contempla mesures de retirada antropogènica de CO2 atmosfèric, per bé que recorda que aquesta tecnologia pot tindre també efectes sobre els cicles biogeoquímics i el clima, i afectar la disponibilitat i qualitat de l’aigua, la producció d’aliments i la biodiversitat.

Lligams:

- IPCC AR6 WGI Full Report.

- IPCC WGI Interactive Atlas.

dissabte, 7 d’agost de 2021

miSHERLOCK: una tecnologia CRISPR per al diagnòstic de variants de SARS-CoV-2

Genètica molecular: Lluís Montoliu, del Centro Nacional de Biotecnología (CNB-CSIC) y del CIBERER-ISCIII, de Madrid, es demana en el darrer número de la Revista del Col·legi de Biòlegs de Catalunya què podem esperar de les eines CRISPR durant aquesta pandèmia COVID-19. Ens recorda que ja en el març del 2020, Feng Zhang proposà l’aplicació del seu sistema SHERLOCK, basat en el sistema CRISPR Cas13a en la detecció de còpies genòmiques de SARS-CoV-2 en mostres clíniques. El cas és que durant tots aquests mesos el diagnòstic d’infecció per SARS-CoV-2 (covid-19) s’ha fet fonamentalment a través de tecnologies d’amplificació (RT-PCR i TMA) i de tests d’antígens. Això entranya una dificultat en el seguiment de les variants de SARS-CoV-2, que es fa amb l’ús de tècniques de seqüenciació genètica, aplicades únicament a una petita mostra dels casos positius de covid-19. James J. Collins, del Wyss Institute for Biologically Inspired Engineering de la Harvard Institute, és l’autor corresponsal d’un article a Science Advances, encapçalat per Helena de Puig, Rose A. Lee i Devora Najjara, en el que es presenta una tècnica SHERLOCK d’instrumentació mínima (miSHERLOCK) per al diagnòstic d’infecció de SARS-CoV-2 i de les variants emergents d’aquest virus. Disposar d’una tècnica així possibilitaria identificar en la saliva de cada pacient de covid-19 quina o quines variants de SARS-CoV-2 l’infecten. La saliva és introduïda a la plataforma de diagnòstic sense processar: hi segueix una extracció, purificació i concentració d’ARN viral, amb reaccions d’amplificació i detecció, que són detectades per fluorescència. L’usuari tan sols hi ha de de fer tres accions, i en una hora obté resposta. La plataforma és capaç d’oferir resultats sobre la presència de SARS-CoV-2 i sobre mutacions associades amb les variants 20I (Alfa, V1), 20H (Beta, V2) i 20J (Gamma, V3). La modularitat del sistema permet un fàcil bescanvi d’assaigs per adaptar-se a les necessitats de l’usuari. També compta amb una aplicació de mòbils per a quantificació de resultats, interpretació automatitzada i distribució remota de les dades.

El dispositiu miSHERLOCK

CRISPR i SHERLOCK

Helena de Puig, Rose A. Lee, Devora Najjar i Xiao Tan dissenyaren i realitzaren experiments, analitzaren les dades i redactaren l’article. Luis R. Soekensen, Nicolaas M. Angenent-Mari, Nina M. Donghia, Nicole E. Weckman, Carlos F. Ng, Peter Q. Nguyen, Audrey Ory, Angelo S. Mao, Thomas C. Ferrante, Geoffrey Lansberry, Hani Sallum i James Niemi realitzaren experiments i editaren l’article. James J. Collins dirigí la recerca i edità l’article, del qual és l’autor corresponsal. Cal recordar que Collins és cofundador i director de Sherlock Biosciences, mentre que Weckman és cofundadora i consultora de 52 North Health Ltd. Els autors agraeixen a M. A. English discussions i assessorament. La recerca es finança a través del Paul G. Allen Frontiers Group, el Wyss Institute for Biologically Inspired Engineering, i dels projectes de Puig, Lee, Tao i Angenent-Mari.

El sistema CRISPR/Cas constitueix un element de la immunitat adaptativa de bacteris i, en aquest sentit, es caracteritza per l’especificitat de resposta a seqüències genètiques. Aquesta especificitat fa que hom l’utilitzi en aplicacions d’edició genètica, però encara més dreturer és utilitzar-lo en diagnòstic molecular.

L’acrònim CRISPR fa referència a repeticions palindròmiques breus regularment espaiades en clústers. L’acrònim SHERLOCK es construeix a partir de “specific high-sensitivity enzymatic reporter unlocking”, i aprofita Cas13a (o Cas12a) per detectar seqüències nucleotídiques específiques.

En el decurs de tots aquests mesos, s’han desenvolupat tests basats en SHERLOCK o en DETECTR per al diagnòstic de la infecció de SARS-CoV-2, però el cert és que no poden oferir gaire més d’allò que ofereixen els altres tests (RT-PCR, TMA, tests d’antígens). El repte de diagnòstic rau en la identificació de variants de SARS-CoV-2, i de mutacions com S:N501Y, S:E484K, que ara es fa en centres especialitzats de seqüenciació: hom té doncs dades epidemiològiques de les variants i de les mutacions de SARS-CoV-2, però en la immensa majoria de pacients de covid-19 no hi ha més que la dada del diagnòstic general.

Puig et al. presenten un miSHERLOCK, és a dir una variant de SHERLOCK d’instrumentació mínima, capaç de la detecció universal de SARS-CoV-2 i de les variants Alpha, Beta i Gamma en mostres de saliva en un sistema autocontingut i de baix cost que fa possible utilitzar-lo en centres d’assistència primària. La plataforma utilitza un mètode de captura d’ARN en paper, amb ulterior amplificació in situ i detecció per Cas. El límit de detecció són 1000 còpies genòmiques/mL. Com a mostra clínica utilitza la saliva, i això fa que el sistema hagi d’incorporar una etapa de filtració i concentració. Encara que el sistema únicament considera les mutacions N501Y i E484K, s’hi poden integrar d’altres com la Y144del.

El disseny del sistema

Per garantir la detecció universal de SARS-CoV-2, s’utilitzaren 43.305 seqüències completes obtingudes de NCBI i alineades amb MAFFT. Per a la variant Alfa, s’empraren 50.001 seqüències genòmiques; per a la variant Beta, 577; per a la variant Gamma, 78.

La seqüència de Cas12 gRNA consta d’una regió de mànec (UAAUUUCUACUAAGUGUAGAU), que permet el reconeixement i unió de la proteïna Cas, i d’una regió adjacent a 3’ que defineix l’usuari segons quina ha d’ésser la diana diagnòstica.

Per a l’amplificació RPA es dissenyaren de 10 a 21 encebadors en els dos sentits per cada diana, amb una longitud d’entre 25 i 40 nucleòtids, i que haurien de donar lloc a amplicons de 100 a 200 parells de nucleòtids.

Com a subjectes experimentals s’utilitzaren mostres clíniques desidentificades procedents de la República Dominicana, i obtingudes a través de Boca Biolistics.

També s’utilitzaren mostres clíniques simulades, elaborades a partir de ATCC VR-1986HK, un preparat inactivat per calor de SARS-CoV-2, que eren abocades a aigua o a saliva humana (adquirida a BioIVT).

Utilitzaren els coronavirus endèmics OC43 i 229E, adquirits d’ATCC, en els experiments d’especificitat.

De Twist Bioscience s’adquiriren variants de SARS-CoV-2 Alfa, Beta i Gamma. També es generaren mutacions sintètiques.

Una vegada seleccionats els reactius, s’utilitzà el programari CAD per dissenyar la plataforma. Els components del sistema foren fabricats amb una impressora 3D en resina negra.

L’aplicació mòbil associada a la plataforma fou construïda amb Xcode, C++, Objective-c, OpenCV 3.1 i Swift.

Construïda la plataforma, es validà amb mostres de pacients.

La diana seleccionada: una regió del gen N

La regió 3’ del genoma dels coronavirus és la més interessant per a les tècniques de detecció, ja que apareix en còpies subgenòmiques produïdes en el decurs de la infecció. En aquesta regió trobem el gen N, que codifica per a la nucleocàpside, proteïna del virió que entra en contacte amb el genoma viral. Puig et al. seleccionaren una regió del gen N altament conservada i característiques de SARS-CoV-2.

El sistema SHERLOCK consta de dos components, un dedicat a l’amplificació isotèrmica de la seqüència diana, i l’altre dedicat a la detecció mediada per Cas de l’amplicó. Aquesta amplificació isotèrmica s’aconsegueix amb un sistema de recombinasa i polimerasa (RPA). És definida pel parell d’encebadors emprats i pels ARN guia (gRNAs). Dels 30 gRNA assajats per Puig et al., el millor és idèntic al 90,7% de les 43.000 seqüències genòmiques contemplades de SARS-CoV-2: l’excepció es deu en un 7,4% dels casos a un polimorfisme C>T de la regió 3’, que no seria problema per a la detecció de Cas12a. Dels 100 parells d’encebadors assajats per Puig et al., el millor és idèntic al 97% dels genomes contemplats.

Puig et al. aconsegueixen percentatges més alts i tot per als gRNA i encebadors dissenyats per a la detecció específica de les variants Alfa, Beta i Gamma.

En les proves realitzades el límit de detecció de l’ARN de SARS-CoV-2 dissolt en aigua per part del miSHERLOCK és de 20.000 còpies/mL, amb un temps de reacció de 55 minuts. No hi ha indicis de reactivitat creuada amb els betacoronavirus endèmics OC43 i 229E.

La mutació S:N501Y, que resulta del polimorfisme A23063U és compartida per les variants Alfa, Beta i Gamma. El gRNA i els encebadors seleccionats per Puig et al. són altament específics per a aquesta mutació, per bé que escapen algunes subvariants amb un polimorfisme G>A en la posició +7 de l’encebador.

La mutació S:Y144del, que resulta d’una deleció de 3 nucleòtids, és característica de la variant Alfa, i permet diferenciar-la de les variants Beta i Gamma. El gRNA i encebadors seleccionats per Puig et al. permeten a miSHERLOCK de discriminar clarament la variant Alfa de la variant originària.

La mutació S:E484K, deguda al polimorfisme G23012A, és present a les variants Alfa, Beta i Gamma, i és potser la més rellevant en termes clínics. El gRNA i encebadors seleccionats per Puig et al. permeten discriminar-la.

La simplificació de passes.

El sistema miSHERLOCK s’adreça a usuaris no-especialistes, que l’operaran sobre mostres de pacients en l’atenció primària, en una oficina de farmàcia o inclús en un entorn no-sanitari. Puig et al. han fet un esforç d’enginyeria per simplificar-ne l’operació. Per això han optimitzat tampons, retrotranscriptases i sistemes de fluorescència. Per exemple, l’addició de la ribonucleasa H (enzim que degrada ARN) millora la cinètica de reacció i augmenta la producció de fluorescència del sistema de detecció.

Puig et al. han adaptat el seu sistema a l’anàlisi de saliva, i no pas a hisops nasofaringis o nasals. La saliva, al capdavall, és més fàcil de collir. Ara bé, aquesta saliva ha d’ésser tractada prèviament, ja que les nucleases salivals podrien generar falsos positius en atacar els reportadors fluorescents. Alhora, el tractament ha de disminuir la viscositat de la saliva, i augmentar l’accessibilitat del material genòmic d’aquesta matriu. El tractament de la saliva que fa el miSHERLOCK inactiva les nucleases (amb ditiotreitol i EGTA), lisa les partícules virals presents (a una temperatura de 95°C), i concentra els àcids nucleics resultants en una membrana porosa (de polietersulfona).

El resultat final del tractament de la saliva és la captura d’àcids nucleics. Llavors comença la reacció pròpiament dita, a una temperatura de reacció de 37°C. Si és present l’àcid nucleic diana, hi ha una generació de fluorescència.

El conjunt del dispositiu diagnòstic té un cost de 15 dòlars USA, i cada assaig costaria 6 $, un preu que es deu sobretot als components enzimàtics de les reaccions d’amplificació i detecció.

L’aparell en funcionament

L’usuari introdueix 2 mL de saliva en el col·lector. Seguidament, activa l’escalfador de l’aparell. En 3-6 minuts, es produeix la deposició de l’ARN salival en la membrana. Llavors l’usuari ha de retirar el col·lector i transferir la columna de preparació de mostra a la cambra de reacció. Llavors s’inicia una reacció de 55 minuts, al cap dels quals l’usuari podrà constatar el positiu a través de la visualització de fluorescència sota el transil·luminador.

Una aplicació mòbil ajuda a la quantificació automatitzada i a la interpretació de resultats. Els valors positius i negatius poden ésser enviats a una base de dades en-línia.

El límit de detecció de miSHERLOCK per a la detecció universal de gen N de SARS-CoV-2 és de 1240 còpies genòmiques/mL. Per posar-ho en context, direm que xifres semblants hem assolit en les aigües residuals de l’àrea metropolitana de Barcelona en els pics de la pandèmia. Els límits de detecció són semblants per a la detecció de les mutacions Y144del i E484K, però són superiors en el cas de la detecció de la mutació N501Y (49000 còpies/mL).

Amb l’ús de 27 mostres de pacients de covid-19 i de 21 mostres control, Puig et al. han obtingut per al seu dispositius una sensibilitat del 96% i una especificitat del 95%.

Perspectives d’aplicació en l’actual context

A hores d’ara tothom és conscient de la importància de disposar de dades precises sobre les variants de SARS-CoV-2 presents en cada context geogràfic i social. El dispositiu de Puig et al. té una gran potencialitat per dissenyar múltiplex de mutacions de SARS-CoV-2 que ens donin informació de la variant concreta que infecta cada pacient. El cost de la prova se situaria al voltant dels 11 $ en el cas d’assaig dúplex.

Quin avantatge ofereix conèixer la variant de SARS-CoV-2 que afecta un pacient? De moment, poca, ja que els protocols que se seguirien d’aïllament i de tractament no difereixen d’acord amb les variants. Però és possible que el desenvolupament i aplicació de tractaments serològics sí requereixi d’un coneixement de la variant que infecta cada pacient. En un escenari d’emergència de variants que escapessin als vaccins, disposar de tècniques que permetin augmentar el nombre de mostres utilitzats al seguiment genòmic del SARS-CoV-2 serà essencial. I aquest escenari potser ens espera d’un moment a l’altre.

Lligams:

- Minimally instrumented SHERLOCK (miSHERLOCK) for CRISPR-based point-of-care diagnosis of SARS-CoV-2 and emerging variants. Helena de Puig, Rose A. Lee, Devora Najjar, Xiao Tan, Luis R. Soekensen, Nicolaas M. Angenent-Mari, Nina M. Donghia, Nicole E. Weckman, Audrey Ory, Carlos F. Ng, Peter Q. Nguyen, Angelo S. Mao, Thomas C. Ferrante, Geoffrey Lansberry, Hani Sallum, James Niemi and James J. Collins. Science Advances 7: eabh2944 (2021).

divendres, 6 d’agost de 2021

SEROCOV: Cinètica d’anticossos d’una cohort de sanitaris amb covid-19

Durant un any (del 19 de març del 2020 a la mateixa data del 2021), el projecte Serocov-1, coordinat per Alberto García-Basteiro i Carlota Dobaño, de l’Institut de Salut Global de Barcelona, estudià la seroprevalença dels treballadors d’hospitals front el SARS-CoV-2, el coronavirus causant de la pandèmia de covid-19. Amb Gemma Moncunill i Carlota Dobaño com a autores corresponsals, i Natalia Ortega com a primera autora, apareix a la revista Nature Communications un article que relata la cinètica dels anticossos anti-SARS-CoV-2 durant els primers set mesos ulteriors a la infecció i que valora el paper que hi juguen els anticossos preexistents contra els coronavirus endèmics (HCoV-229E, -NL63, -OC43, i -HKU1). En el marc del projecte SeroCov, s’avaluaven amb Luminex els nivells d’anticossos (IgM, IgA, IgG) contra sis antígens de SARS-CoV-2 i contra l’antigen de nucleocàpside dels coronavirus endèmics 229E, NL63, OC43 i HKU1. La capacitat de neutralització per anticossos era valorada per citometria de flux. La cohort d’estudi era formada per 578 treballadors sanitaris de l’àmbit hospitalari, i el període de seguiment abastava fins a 7 mesos. A temps 0, la seroprevalença era del 13,5%, i en el mes 1 ja arribava al 15,6%, per tocar els 16,4% a 6 mesos. Els nivells d’anticossos i la capacitat neutralitzant es demostrava estable al llarg del temps, per bé que la IgG anti-N i la IgM en general tendeixen a esvair-se. Després d’arribar al pic de resposta, els anticossos anti-S experimenten un augment a 150 dies de l’aparició dels primers símptomes en tots els individus, i en el 73% pel que fa a la IgG, i això malgrat que no hi hagi cap re-exposició al virus. Entre els individus seropositius, els valors d’IgG i d’IgA als coronavirus endèmics són més elevats entre els qui passaren la covid-19 sense símptomes que els qui la passaren amb símptomes, cosa indicativa del valor que té l’exposició prèvia als coronavirus endèmics en la paucisimptomaticitat de la covid-19.

Cinètica de la capacitat neutralitzant d’anticossos anti-SARS-CoV-2

L’estudi SeroCov

Ana Angulo, Alberto L. García-Basteiro, Pablo Engel, Gemma Moncunill i Carlota Dobaño dissenyaren aquest estudis. Angeline Cruz, Montserrat Lamoglia, Natalia Ortega, Marta Ribes, Neus Rosell, Ruth Aguilar, Diana Barrios, Dobaño i Sarah Williams recrutaren participants, recolliren dades i obtingueren mostres clíniques. Alfons Jimenez, Marta Vidal, Aguilar, Rocío Rubio, Barrios, Robert A. Mitchell, Laura Puyol, Selena Alonso i Chenjerai Jairoce processaren les mostres, desenvoluparen i realitzaren els assaigs serològiques i les anàlisis. Angulo, Engel i Pablo Hernández-Luis realitzaren l’assaig de neutralització per citometria de flux. Edwards Pradenas, Benjamin Trinité i Julià Blanco realitzaren l’assaig de neutralització basat en pseudovirus. Aguilar, Rebeca Santano, Sonia Barroso, Anna Vilella, Anna Llupià, Antoni Trilla, Pilar Varela i Marta Tortajada contribuïren al disseny i a la interpretació crítica dels resultats. Jordi Chi, Luis Izquierdo, Natalia Rodrigo Melero, Carlo Carolis, Pau Serra, Daniel Parras i Pere Santamaria produïren els anticossos. Ortega i Ribes analitzaren les dades, amb el suport de Santano. Susana Méndez gestionà les dades clíniques. Moncunill i Dobaño supervisaren els assaigs d’anticossos i les anàlisis de dades. El primer redactat de l’article fou realitzat per Ortega, Ribes, Moncunill i Dobaño, i tots els autors aprovaren la versió final, tramesa a Nature Communications el 3 de març del 2021. L’article fou acceptat per a publicació el 16 de juliol, i publicat el 6 d’agost.

L’estudi caracteritza la cinètica d’anticossos i de la corresponent capacitat de neutralització entre març i octubre del 2020 en quatre exploracions transversals sobre la mateixa cohort de treballadors sanitaris d’hospitals. Hom valorar tres isotips (IgM, IgG i IgA) contra sis antígens del betacoronavirus SARS-CoV-2. Alhora hom valora els anticossos contra l’antigen N dels quatre coronavirus endèmics coneguts en humans: els alfacoronavirus 229E i NL63, i els betacoronavirus OC43 i HKU1. Val a dir que aquests quatre coronavirus endèmics eren responsables de vora un 10% de les infeccions agudes respiratòries abans de l’esclat de la pandèmia de covid-19.

Una cohort de 578 treballadors hospitalaris

Els 578 treballadors sanitaris de l’Hospital Clínic de Barcelona que fan part de la cohort de SeroCov foren seleccionats aleatòriament. En el marc del SeroCov se n’ha fet un seguiment en quatre visites:
- la primera (M0) entre el 28 de març i el 9 d’abril del 2020, amb 578 participants.
- la segona (M1) entre el 27 d’abril i el 6 de maig del 2020, amb 566 participants.
- la tercera (M3) entre el 28 de juliol i el 6 d’agost del 2020, amb 70 participants, ja que es convidà exclusivament als participants previs que havien mostrat indicis d’infecció per SARS-CoV-2.
- la quarta (M6) entre el 29 de setembre i el 20 d’octubre del 2020, amb 507 participants.

D’aquesta manera, resulta que en un dels participants el període de seguiment fou de 231 dies (7,7 mesos).

En els primeres visites (M0 i M1) es recollien hisops nasofaringis per fer-hi una rRT-PCR específica de SARS-CoV-2 i mostres de sang per a estudis serològics. Era en la primera visita que es recollia el consentiment informat, d’acord amb el protocol aprovat pel Comitè Ètic de l’Hospital Clínic.

A través de Luminex es valoraven els anticossos IgM, IgG i IgA adreçats a tota la proteïna S de SARS-CoV-2, a les seves subregions S1 i S2, i al domini d’unió a receptor (RBD) que es troba a la regió S1; a tota la proteïna N de SARS-CoV-2 i a la seva regió C-terminal; a tota la proteïna N dels HCoVs HKU1, 229E, OC43 i NL63.

Els anticossos neutralitzants eren estimats d’acord amb el percentatge d’inhibició de la unió de RBD al receptor (ACE2) pel plasma dels participants, valorat en un assaig in vitro de citometria de flux, en una línia cel·lular estable murina que expressa el receptor ACE2, que és exposada a la proteïna de fusió RBD-mFc.

507 individus participaren en la quarta visita

De la cohort inicial, un 12,3% no acudiren a la quarta visita, sis mesos després del recrutament. Sí acudiren 507 individus, amb una edat de 42,7±11,2 anys, dels quals el 72% eren dones. Les mostres obtingudes en les visites anteriors (M01, M1 i M3) i en aquesta visita (M6) foren assajades de nou: si la seroprevalença a M0 era del 13,5%, es passava al 15,6% en la M1 i al 16,4% en la M6.

És interessant remarcar que entre les visites M1 i M3 s’observaren seroreversions d’indivus seropositius en M0 per a IgA i IgM per a tots els antígens, en percentatges respectius del 30% i el 24,5%. No obstant, entre la M3 i M6 no s’observà cap seroreversió.

Pel que fa a la professions hospitalàries, metges i psicòlegs mostren un 50% menys de risc d’infecció que infermeres i auxiliars. De les infeccions produïdes en la cohort d’estudi, el 69% foren simptomàtiques, i en un cas calgué fins i tot hospitalització.

Les dades de 76 participants simptomàtics

Amb 235 mostres de 76 participants simptomàtics, Ortega et al. estudien la cinètica d’anticossos anti-SARS-CoV-2 en relació al dia d’aparició dels primers símptomes. La cinètica és semblant tant en els casos simptomàtics com en els asimptomàtics.

Les IgA i IgM fan un pic en el primer mes posterior a l’aparició dels primers símptomes. El pic d’IgG es produeix al voltant del dia 50. Els nivells IgG contra antígens S (S, S1, S2 i RBD) es mantenen estables, com també ho fan els IgA, fins a 230 dies després de l’aparició dels primers símptomes. De fet, vora el 70% dels participants conservaven la seropositivitat a sis mesos després de l’aparició dels primers símptomes. Els nivells d’IgM, en general, i els nivells d’IgG contra antígens N tendien més clarament al declivi, de manera que a sis mesos tan sols el 34% dels participants retenia la seropositivitat per a IgM, i el 26% per a IgG anti-N.

A partir del dia 150 es registra una tendència a l’augment dels nivells d’anticossos. La cinètica permet distingir entre individus en els quals decau el nivell d’anticossos en les visites M1-M3 i els qui sostenien o augmentaven aquest nivell.

Pel que fa a la capacitat neutralitzant del plasma de persones amb covid-19 simptomàtica, aquesta augmenta fins el dia 80, i roman estable fins més enllà del dia 250.

El rol d’anticossos contra els coronavirus endèmics en la covid-19

En mostres de plasma anteriors a la pandèmia és possible registrar reactivitat d’anticossos contra antígens SARS-CoV-2, i particularment contra la proteïna N. Això s’atribueix a anticossos generats arran d’infeccions amb els coronavirus endèmics. Durant la primera onada, hom suposà que la relativa resistència dels infants a la infecció greu per SARS-CoV-2 era deguda a aquesta immunitat creuada.

Ortega et al. analitzaren els nivells d’anticossos contra antígens N de coronavirus endèmics en 33 participants que s’infectaren de SARS-CoV-2 en el decurs de l’estudi. Val a dir que la seroconversió per SARS-CoV-2 també s’associava a una tendència a l’alça dels nivells d’anticossos contra proteïnes N de coronavirus endèmics, particularment en el cas del 229E.

Un nivell d’IgG anti-229E i anti-NL63 en la M0 s’associava a un menor risc de seroconversió per SARS-CoV-2. De tota manera l’associació més robusta es trobava entre els nivells d’IgA anti-OC43 i la protecció front a covid-19 simptomàtica en el cas d’infectar-se per SARS-CoV-2.

Lligams:

- Seven-month kinetics of SARS-CoV-2 antibodies and role of pre-existing antibodies to human coronaviruses. Natalia Ortega, Marta Ribes, Marta Vidal, Rocío Rubio, Ruth Aguilar, Sarah Williams, Diana Barrios, Selena Alonso, Pablo Hernández-Luis, Robert A. Mitchell, Chenjerai Jairoce, Angeline Cruz, Alfons Jimenez, Rebeca Santano, Susana Méndez, Montserrat Lamoglia, Neus Rosell, Anna Llupià, Laura Puyol, Jordi Chi, Natalia Rodrigo Melero, Daniel Parras, Pau Serra, Edwards Pradenas, Benjamin Trinité, Julià Blanco, Alfredo Mayor, Sonia Barroso, Pilar Varela, Anna Vilella, Antoni Trilla, Pere Santamaria, Carlo Carolis, Marta Tortajada, Luis Izquierdo, Ana Angulo, Pablo Engel, Alberto L. García-Basteiro, Gemma Moncunill & Carlota Dobaño. Nature Communications 12: 4740 (2021).

- SeroCov-1, a la pàgina d’ISGlobal.

dimecres, 28 de juliol de 2021

Porífers en esculls de fa 890 milions d’anys?

Paleontologia: Elizabeth C. Turner, professora de sedimentologia de carbonats i de paleontologia d’invertebrats a la Université Laurentienne, proposa en un article a la revista Nature que microestructures vermiformes de fòssils de fa 890 milions d’anys es corresponen a demosponges. Si la interpretació és certa serien els primers testimonis fòssils de metazous. El cas és que les dades de filogènia molecular indiquen que els metazous s’originaren a començament del Neoproterozoic, però fins ara hom no havia trobat evidències físiques que datessin d’aquest període. Alguns estudis de filogènia molecular assenyalen a les esponges com el tipus animal més bàsic, i així doncs hom esperaria trobar en el Neoprotezoic primerenc fòssils d’esponges. És sabut que les demosponges keratosanes no-espiculars poden donar lloc microestructures vermiformes en sediments carbonacis corresponents a esculls. Turner presenta exemples d’aquestes microestructures petrogràfiques en sediments de 890 milions d’anys d’antiguitat. Cal pensar, doncs, que ja en aquella època hi havia organismes vermiformes de mm a cm de longitud, que vivien en el context d’esculls edificats per cianobacteris calcificants. Aquests organismes vermiformes aprofitarien nínxols ecològics on no podien viure els calcimicrobis. Si aquests organismes són realment emparentats amb els metazous del fanerozoic, la fauna del neoproterozoic primerenc hauria tingut el mèrit d’aparèixer abans de l’oxigenació neoproterozoica i de sobreviure a les glaciacions globals del criogenià.

Imatges de microstructes vermiformes de Little Dal

La vida en el Criptozoic

Poden dividir la història de la biosfera en dues etapes: la fanerozoica, de vida aparent, que data de fa 541 milions d’anys, i l’anterior, la criptozoica (o pre-fanerozoica). Els fòssils del criptozoic són ben poc pregons: estructures microbianes bèntiques, com els estromatòlits i altres microbiàlits, són de difícil interpretació, i preserven més funcionalitats que estructures biològiques.

Durant molt de temps hom assumia que els metazous o animals pluricel·lulars, havien aparegut a començament del fanerozoic. No obstant, en el darrer període del neoproterozoic, l’ediacarà, s’han identificat fòssils d’animals bilaterals i també hi ha evidència indirecta de porífers o esponges.

Hom tendeix a suposar que les esponges són els metazous més bàsics. Ara bé, dins de les esponges les que fossilitzin millor són les que tenen esquelets mineralitzats (amb espícules silícies o calcàries). Però potser les més bàsiques són les esponges d’esquelets exclusivament proteics, fets d’espongina o de queratina.

En fòssils d’esculls i estromatòlits del fanerozoic hom ha atribuït recentment a esponges queratoses microestructures vermiformes abans assignades a algues o protozous. Es tracta de microestructures tubulars anastomosants incloses en carbonats. Tafonòmicament, les demosponges queratoses, pateixen una calcificació post-mortem que dóna lloc a una automicrita: gràcies a això, una vegada es degrada l’espongina, queda un motllo que reprodueix l’estructura de l’esponja tova.

Els esculls de Little Dal

Turner ha realitzat un estudi petrogràfic en seccions fines (de 30 μm de gruix) observades al microscopi d’esculls de Little Dal, corresponents a la Formació de Stone Knife, del nord-oest de Canadà, i que tenen una antiguitat de 890 milions d’anys. Els esculls, amb gruixos de 500 metres, i diàmetres de diversos quilòmetres, foren el producte de microorganismes, particularment de calcimicrobis, identificats com a cianobacteris filamentosos. L’escull permetia elevar aquests organismes marins 100 metres per damunt del fons, i arribar així a la capa fòtica, per realitzar fotosíntesi.

Els esculls de Little Dal es corresponen a la formació de Stone Knife, de 892 ± 13 milions d’anys d’antiguitat

Els escull creixien en cinc estadis, els primers (I-III) sense morfologia consisteix, i el cinquè amb una morfologia més complexa. En aquest cinquè estadi, els calcimicrobis no són tan presents, possiblement perquè se situaven massa a prop de la superfície de l’aigua, en un entorn massa energètic.

La microestructura vermiforme apareix tan sols rarament en mostres dels estadis II, III i V. Consisteixen en masses de mm a cm de mida de tubs anastomosants. Apareixen en tres microfàcies, corresponents a tres paleoambients diferents. No hi ha microestructures vermiformes en els estromatòlits dominants pels calcimicrobis, ni tampoc en la part més fonda de l’escull.

Els fòssils de metazous més antics?

Turner posa de manifest totes les similituds en termes de forma i mida dels túbuls vermiformes de Little Dal amb les xarxes de l’esponges queratosanes modernes o amb els fòssils fanerozoics d’aquests organismes.

Ho interpreta, doncs, com a esponges que colonitzaven ambients dels esculls que no eren habitats pel calcimicrobis fotosintètics, com ara els flancs, depressions en la superfície activa de creixement, o en forats de l’estructura. Les esponges podien viure, doncs, en entorns de l’escull que romanien permanentment fora de la llum, però no ho podien fer si hi havia massa activitat dels calcimicrobis fotosintètics. El cas és que les esponges de Little Dal requerien l’oxigen molecular (llavors escàs en l’oceà) generat per les comunitats cianobacterianes: per ells, l’escull era un “oasi oxigènic”, en el benentès, que la tensió d’oxigen d’aquest entorn era ben microoxigènica en termes actuals.

Si les esponges fòssils de Little Dal són acceptades com a tal, demostrarien que els primers metazous s’haurien originat abans de l’anomenada “oxigenació neoproterozoica”. D’altra banda, serien un testimoni de la continuïtat de llinatges metazoics entre el Neoproterozoic primerenc i el Neoproterozoic tardà, creuant les grans glaciacions globals del període intermedi.

Mostres recollides entre el 1992 i el 2018

Les mostres emprades per Turner foren recollides en diversos moments entre 1992 i 2018. El treball de camp no era gens fàcil, ja que es tractava de localitats únicament accessibles per helicòpter, i la presa de mostres es feia a peu.

Lligams:

- Possible poriferan body fossils in early Neoproterozoic microbial reefs. Elizabeth C. Turner. Nature (2021).

diumenge, 11 de juliol de 2021

Els riscos de la cinquena onada de covid-19

Salut pública: En una lletra a The Lancet, Deepti Gurdasani et al. alerten contra la idea que, una vegada immunitzada la població de més risc amb vaccins, la infecció massiva sigui una opció en la gestió de la pandèmia. L’article fa referència a la situació actual de “tercera onada” que es viu al Regne Unit que prepara el 19 de juliol el final de totes les restriccions.

El debat té les seves dificultats. Les restriccions que s’han imposat fins ara han navegat entre la contenció dels contagis i el manteniment d’activitats considerades més o menys essencials. Per això les restriccions s’han concentrat més en el món de l’oci que en el del treball. Alhora, la combinació de recomanacions i restriccions ha estat complexa, ja que les segones requereixen d’uns sistemes de vigilància o de coerció perquè siguin efectives.

Davant de l’actual onada de covid-19, hom ha assenyalat que el programa de vaccinació focalitzat en la gent gran ha trencat el vincle entre la infecció i la mortalitat. La forta mortalitat associada a la primera onada de covid-19 fa que les xifres actuals de mortalitat semblin més o menys acceptables. D’altra banda, el programa de vaccinació no sols protegeix de la mort de la covid-19, sinó que també redueix el percentatge de casos que requereixen ingressos hospitalaris (especialment, en UCIs).

En l’estratègia de la infecció massiva hi ha la idea que la immunitat de grup es pot assolir amb la combinació de l’extensió del programa de vaccinació i les infeccions massives de gent jove. Els experts recorden que la immunització més elevada es troba en aquelles persones que han combinat infecció natural i una dosi de vaccí d’ARNm.

Les xifres d’aquesta setmana a Catalunya indiquen un augment diari de més d’un punt percentual de la població que ha rebut la pauta completa de vaccinació. Per contra, en l’àrea metropolitana de Barcelona, el percentatge de població amb infecció activa deu rondar l’1%. Fins i tot en mig de la cinquena onada, doncs, la vaccinació és molt més efectiva com a immunitzadora que la transmissió natural.

Cal no oblidar que la infecció natural per SARS-CoV-2 entranya un risc de malaltia aguda i de complicacions de llarg termini molt més elevada que la vaccinació. “Només l’1% de les infeccions cursen de manera grau” és una frase que té poc sentit: un 1% de 100.000 persones és una xifra deu vegades superior a un 1% de 10.000 persones.

Gurdasani et al. citen cinc raons contra l’estratègia d’infecció massiva:
- la transmissió descontrolada a hores d’ara se centra en la població jove (nens, adolescents i joves) que no ha estat vaccinada. La taxa d’atac real del SARS-CoV-2 podria voltar el 20%, però no seria gaire superior, de manera que el SARS-CoV-2 compta encara amb una població susceptible descomunal (uns 17 milions al Regne Unit, per exemple). La variant delta de SARS-CoV-2 sembla més transmissible que els anteriors però conserva la patogenicitat, de manera que si se la deixa atacar a tota la població susceptible, en resultarien al Regne Unit centenars de milers de persones amb malaltia i discapacitat de llarg termini a una edat ben jove: l’impacte perduraria durant dècades.
- una alta transmissió en escoles i altres espais infantils comportarà més disrupció educativa. Sobre aquest punt Gurdasani et al. són clars: no és pas l’aïllament de positius i contactes la que provoca la disrupció educativa sinó la transmissió del virus. Al capdavall, la imperfecció del sistema de detecció fa que la majoria de casos infantils de covid-19 no siguin detectats ni isolats. La infecció massiva en escoles afectaria als infants més vulnerables per raons clíniques i socials. Una infecció massiva estival genera un reservori d’infecció que facilitarà una nova onada de tardor amb la represa d’escoles i d’universitats a partir de setembre.
- una infecció massiva és el terreny propici per a l’aparició de variants que siguin resistents als vaccins. Entre l’aparició d’una variant així i la consecució de nivells suficients d’immunització amb nous vaccins passarien mesos que reproduirien les primeres onades de covid-19.
- l’actual onada ja es deixa notar amb força en l’atenció primària, amb impacte en els serveis de salut i el personal sanitari. A Catalunya, la cinquena onada es notà primer en els positius detectats, després en l’atenció primària, seguidament en hospitals i ara, incipientment, en les UCIs.
- la covid-19 impacta especialment les comunitats més vulnerables i marginalitzades, de manera que cada nova onada aprofundeix les desigualtats prèvies.

Quines mesures defensen Gurdasani et al.? D’una banda, les mesures de salut pública recomanades per l’OMS, de distància interpersonal, higiene de mans i ventilació, així com l’ús de mascaretes en espais tancats compartits. De l’altra, un bon sistema de tests i de traçabilitat de contactes, que també passa per donar suport i no pas abandonar a les persones que han de fer quarantenes. El programa de vaccinació hauria d’incloure adolescents i joves. Mentrestant, espais compartits com les escoles haurien de comptar amb monitors de CO2, dispositius de filtració de l’aire i una reducció efectiva de la mida de les classes.