dissabte, 13 de juliol del 2024

L’absorció dels neandertals en el pool genètic humà modern

Paleogenètica: En l’actualitat hi ha una sola espècie humana, Homo sapiens. Però en el passat han coexistit diferents grups d’hominins. Ara bé, entre aquests grups d’hominis, considerats espècies diferenciades, hi podia haver un flux gènic. La caracterització de l’home de Neandertal com una espècie separada, H. neanderthalensis s’interpretà originalment com una barrera per al flux gènic amb els ancestres dels humans moderns. Però els estudis genòmics fa dècades que han identificat en el genoma humà modern seqüències explicables per la introgressió de material genètic neandertal. Aquesta introgressió ha participat en l’evolució adaptativa dels genomes humans moderns. En sentit contrari, també entrà en el genoma dels Neandertals material genètic dels primers humans moderns. Li Liming, Troy J. Comi, Rob F. Bierman i Joshua M. Akey publiquen un article a la revista Science on proven de reconstruir la dinàmica d’aquests bescanvis genètics al llarg de 200.000 anys. Se centren en seqüències d’humans moderns introduïdes en el genoma de Neandertals, i en com aquestes haurien afavorit un augment local d’heterozigositat en la població neandertal. Per fer-ho aplicaren primer el mètode IBDmix en la identificació de seqüències neandertals en 2000 genomes humans moderns que fan part del 1000 Genomes Project. En el cas de genomes humans moderns africans, les seqüències neandertals coincideixen amb aquelles que en el genoma neandertal mostren una elevada heterozigositat. En genomes humans moderns no-africans no s’observa aquesta coincidència. La discrepància s’explicaria a través d’un flux genètic d’humans moderns a neandertals. Així el genoma neandertal de Vindija tindria una aportació d’humans moderns del 2,5% (53,9 Mb) i el genoma neandertal d’Altai una del 3,7% (80,0 Mb). Li et al. mostren que fins ara s’havia sobreestimat la mida de les poblacions neandertals. Alhora distingeixen dues èpoques diferents en l’entrada de material genètic d’humans moderns en les poblacions neandertals. La població neandertal en la fase final es trobava en una tendència de minvament que culminà en la seva absorció dins del pool genètic humà modern.

Li et al. han estudiat el flux gènic entre neandertals i humans moderns durant els darrers 200.000 anys. Això els ha permès estimar la població relativa de neandertals respecte de la dels humans moderns. Alhora han identificat dos polsos de flux genètic d’humans moderns a neandertals.

L’ADN antic

Aquesta recerca fou concebuda pel professor Joshua M. Akey i per l’investigador associat Liming Li. La metodologia fou dissenyada per Akey i Li. La recerca fou duta a terme per Akey, per Li, pel químic Troy J. Comi i pel bioinformàtic Rob F. Bierman. Els gràfics foren elaborats per Akey i Li.

Els autors agraeixen a membres del laboratori d’Akey per l’assistència, i en especial ho fan per a S. Moon, A. B. Wolf, K. Zhang, D. Tagore, and H. Xu. Agraeixen a F. Mafessoni (MPI d’Antropologia Evolutiva) i K. Prüfer (MPI de Ciència de la Història Humana) per orientacions en història demogràfica. Agraeixen a B. Vernot (MPI d’Antropologia Evolutiva) per dades dels genomes neandertals d’Altai i de Vindija. La tasca computacional d’aquest estudi es va fer a la Princeton University.

La recerca es finança amb un ajut dels National Institutes of Health a Akey, qui administra el projecte, i el supervisà.

La tecnologia d’ADN antic no tan sols ha permès conèixer millor l’home de Neandertal, sinó que també ha permès definir grups humans arcaics prèviament desconeguts, com l’home de Denisova. La distintivitat de grups humans no suposà una barrera absoluta al flux gènic. Així doncs, estudis d’ADN antic han constatat l’existència de barreja entre els homes moderns (Homo sapiens), neandertals i denisovans.

Hom disposa essencialment de la seqüència genòmica completa amb alta cobertura de tres individus neandertals i d’un individu denisovà. Els tres individus neandertals són identificats pels indrets on es trobaren les restes: la cova de Vindija (Croàcia), la cova de Chagyrskaya (Muntanyes Altai) i Altai (Denisova 5). L’individu denisovà és Denisova 3. És significatiu que a la cova de Denisova hom hagi trobat alhora denisovans (com Denisova 3) i neandertals (com Denisova 5).

Amb aquests quatre genomes antics i amb milers de genomes complets d’humans actuals hom ha pogut descriure la xarxa d’interaccions genètiques, incloent-hi el flux gènic entre humans moderns i neandertals, entre humans moderns i dues poblacions diferenciades de denisovans, i entre neandertals i denisovans. A Denisova hom ha arribat a trobar un individu que seria fill de mare neandertal i pare denisovà.

En humans moderns la presència de seqüències genòmiques derivades de neandertal és variable. Entre les poblacions humanes modernes d’Àfrica aquest percentatge se situa en un 2%. Pel que fa a les seqüències genòmiques derivades de denisovans, les poblacions modernes d’ascendència melanèsia i aborigen australià tenen un 2-5%, situant-se el valor més elevat en certs grups filipins.

Hom ha catalogat seqüències introgressades de neandertals i denisovans, i s’han estudiat el que impliquen funcionalment, fenotípicament i evolutivament. Les introgressions neandertals en humans moderns han estat objecte d’una selecció purificadora i positiva.

Pel que fa a la introgressió del genoma humà modern en neandertals hom ha trobat indicis d’un flux gènic força antic, anterior a la dispersió fora d’Àfrica dels humans moderns de fa 60.000 anys. Aquest primer flux gènic s’hauria produït fa 250.000-200.000 anys.

Fa 60.000-50.000 anys trobem un flux gènic des dels neandertals als humans moderns.

Com que tant Vindija com el neandertal d’Altai mostren indicis d’introgressió de seqüències d’humans moderns, cal pensar que aquest flux gènic és anterior a la divergència de Vindija i Altai.

La introgressió humana moderna en el genoma de neandertals

Li et al. recorden que la mida poblacional efectiva dels neandertals era molt limitada. També remarquen que la introgressió neandertal en genomes humans moderns d’Àfrica pot reflectir la introgressió humana moderna en neandertals.

Com que la mida poblacional dels neandertals era inferior a la mida poblacional dels humans moderns de la mateixa època, una introgressió dels segons cap als primers hauria de resultar en un augment local del nivell d’heterozigositat. Li et al. prediuen que hi hauria una superposició entre les regions d’alta heterozigositat del genoma de neandertals i les seqüències d’introgressió neandertal en humans moderns africans: aquesta superposició no seria tan evident en el cas dels humans moderns no-africans.

Heterozigositat en neandertals i introgressió en humans moderns

Li et al. apliquen la metodologia IBDmix al genomes de 2000 individus actuals del 1000 Genomes Project. IBDmix és capaç de detectar seqüències d’introgressió en un genoma problema comparant-lo amb un genoma arcaic de referència. Per evitar falsos negatius cal establir una mida mínima dels segments a estudiar (expressada en unitats de distància genètica). Li et al. apliquen un llindar mínim de 0,05 centimorgans.

Amb aquest llindar, i emprant diferents genomes arcaics troben:
- emprant com a genoma de referència el neandertal de Vindija troben 92,4 gigabases d’introgressió en tots els 2000 individus moderns.
- emprant com a genoma de referència el neandertal d’Altai troben 85,5 Gb d’introgressió en tots els 2000 individus moderns.
- emprant com a genoma de referència el neandertal de Chagyrskaya troben 84,3 Gb d’introgressió en tots els 2000 individus moderns.

Quan hom es fixa en els individus africans d’aquests 2000 genomes moderns, la introgressió neandertal se superposa significativament amb regions d’alta heterozigositat del genoma neandertal. Així, per exemple, el 60% de les seqüències que ocupen el primer vigintil d’heterozigositat del genoma del neandertal d’Altai són seqüències d’introgressió neandertal en humans moderns africans; aquest mateix percentatge baixa al 23% si hom es fixa en la introgressió neandertal en humans moderns no-africans. Un patró semblant s’observa en els genomes neandertals de Vindija i Chagyrskaya.

L’heterozigositat neandertal de regions que se superposen a seqüències d’introgressió en africans moderns és 8,6 vegades superior a les que se superposen a seqüències d’introgressió en no-africans moderns.

L’heterozigositat denisovana de regions que se superposen a seqüències d’introgressió en africans moderns és només un 30% superior a les que se superposen a seqüències d’introgressió en no-africans moderns.

Altres estudis previs han mostrat una superposició entre les regions del genoma neandertal d’Altai amb alta heterozigositat amb les regions que tenen alta heterozigositat en humans moderns. Tot plegat indica que les regions d’alta heterozigositat del genoma neandertal s’associen amb regions d’introgressió moderna.

Els components del flux gènic

Les seqüències d’introgressió neandertal en genomes moderns són el resultat bé del flux gènic sapiens → neandertal o del flux gènic invers neandertal → sapiens. Per diferenciar-los, Li et al. opten per comparar la introgressió en africans moderns amb la introgressió en europeus moderns.

Li et al. han simulat 15 Mb de seqüència de 503 europeus moderns, 108 africans moderns i 3 neandertals. Contemplen dues situacions extremes:
- 1, que tota la introgressió neandertal en humans moderns africans s’explica pel flux gènic sapiens → neandertal.
- 2, que tota la introgressió neandertal en humans moderns africans s’explica pel flux gènic neandertal → sapiens extraafricans, seguit d’un flux gènic sapiens extrafricans → sapiens africans.

Les dades afavoreixen la primera opció en detriment de la segona

El nivell d’introgressió sapiens en genoma neandertal

Li et al. estimen que el genoma neandertal de Vindija contenia 53,9 Mb de seqüència d’introgressió sapiens. La xifra és encara superior en el genoma neandertal d’Altai: 80,0 Mb. Això es tradueix, respectivament, en una introgressió del 2,5% i del 3,7%. Dit d’una altra manera, la introgressió sapiens en el genoma neandertal fou superior a la introgressió neandertal en el genoma dels humans moderns.

La introgressió sapiens en el genoma neandertal s’associa amb funcions biològiques com l’activitat de transport transmembrana d’ions metàl·lics o la via de senyalització del receptor glutamat. Aquestes funcions corresponen a gens que influeixen en la biologia del sistema nerviós central i en la captació i metabolisme de neurotransmissors: CACNG2, GRIA1, SLC6A11, GRIN2B, GRIK2 i GRM7.

La introgressió neandertal en humans moderns

Li et al., aplicant l’IBDmix sobre els 2000 genomes moderns esmentats amb el genoma neandertal Vindija com a referència troben les següents xifres d’introgressió neandertals:
- 62,3 Mb en asiàtics orientals.
- 60,1 Mb en sud-asiàtics.
- 55,8 Mb en europeus.

En més d’un 90% aquesta introgressió s’atribuiria a un flux gènic neandertal → sapiens.

Les xifres d’introgressió neandertal en genomes humans moderns africans aniria de 1,8 Mb a 2,9 Mb.

L’estimació de la mida poblacional efectiva dels neandertals

Si hom contempla exclusivament una introgressió pel flux gènic neandertal → sapiens, la mida de població efectiva a llarg termini del neandertals d’Altai seria de 3369 (amb un interval de confiança d’entre 3036 i 3520), la del neandertal de Chagyrskaya seria de 2964 (2765-3148) i la del neandertal de Vindija de 3408 (3209-3554).

Però quan Li et l. retiren de l’anàlisi les seqüències d’introgressió sapiens d’aquests genomens de neandertals, la mida de població efectiva davalla força: per Altai queda en 2484 (2223-2639), per Chagyrskaya en 2379 (2181-2569) i per Vindija en 2807 (2622-2959).

Quan hom fa la mateixa operació per als denisovans, l’estimació de la mida de població efectiva es manté tant si es considera la introgressió moderna (3824) com si no (3899).

El llinatge de neandertals d’Altai mostra una mida poblacional inferior a la dels llinatges de neandertals d’Europa. Però en tot car Li et al. remarquen que la mida poblacionals dels neandertals és menor i més variable que no pas s’havia estimat prèviament. Una mida poblacional més petita magnifica els efectes de la deriva gènica, com ara l’acumulació de mutacions deletèries.

Dos polsos diferents del flux genètic neandertal → sapiens

Li et al. estimen que hi hagué en un període ben primerenc un flux genètic sapiens → neandertal. Si aquest flux tingué lloc fa 250.000 anys hauria tingut una magnitud del 10% sobre el genoma neandertal. Si hagués estat fa 200.000 anys, la magnitud hauria estat inferior (d’un 5%).

L’antiguitat del genoma neandertal d’Altai és de 120.000 anys. La del neandertal de Chagyrskaya és de 80.000 anys. I la del neandertal de Vindija és de 52.000 anys. Els dos darrers genomes van rebre una aportació addicional de flux gènic procedent de sapiens. Aquest segon pols s’hauria produït fa 100.000 anys i tindria una magnitud del 0,5%.

Una història complexa

Fa 250.000-200.000 anys hauria començat doncs un episodi de flux gènic entre els ancestres dels humans moderns i els neandertals, en un sentit essencialment sapiens → neandertal. Aquest episodi es relacionaria amb una primera dispersió de poblacions sapiens fora de l’Àfrica on s’havien originat. Els primers humans anatòmicament moderns haurien aparegut a Àfrica fa 300.000 anys. El fòssil Apidima 1 mostra la presència d’humans moderns a la Grècia de fa 210.000 anys.

Fa 120.000-100.000 anys hauria tingut lloc un segon episodi de flux gènic sapiens → neandertal. Aquest flux gènic es relacionaria amb la formació del pont de terra emergida Nil-Sinaí, que es mantingué en el període de fa 130.000 a 96.000 anys. Es manifesta en el registre fòssil en la presència d’humans moderns a Orient Mitjà i a la Península Aràbiga.

De tota manera, l’onada més rellevant en la conformació de les poblacions humanes modernes d’Euràsia es produeix fa 60.000-50.000 anys.

Li et al. constaten que el flux gènic sapiens → neandertal més abundant (5-10%) és el de fa 250.000-200.000 anys. En el període de fa 120.000-100.000 anys el flux gènic sapiens → neandertal és del 0,5%. I, ja en el període final dels neandertals, fa 47.000-39.000 anys, el flux gènic sapiens → neandertal és pràcticament zero.

En canvi, el flux gènic neandertal → sapiens creix especialment fa 60.000-50.000 anys. Es manté encara un nivell elevat d’aquest flux fa 45.000-39.000 anys.

La raó de la unidireccionalitat d’aquests flux s’explicaria per un decreixement de la mida de la població efectiva dels neandertals. A partir d’un moment aquesta mida feia impossible que els neandertals absorbissin les poblacions humanes modernes, com sí havien fet en les onades de fa 200.000 i fa 100.000 anys. Llavors el flux neandertal → sapiens reflectia de fet l’extinció dels primer, en ésser assimilats per les poblacions humanes modernes a mesura que aquestes es dispersaven per tot Euràsia.

Signes d’aquesta assimilació dels neandertals es manifestaren en el llinatge masculí que representa el cromosoma Y (amb l’extinció dels haplotips neandertals) i en el llinatge femení que representa l’ADN mitocondrial (amb l’extinció dels haplotips neandertals).

Lligams:

- Recurrent gene flow between Neanderthals and modern humans over the past 200,000 years. Liming Li, Troy J. Comi, Rob F. Bierman, Joshua M. Akey. Science (2024)

divendres, 5 de juliol del 2024

La mutació c.1586C>T; p.Pro529Leu en el gen ARPP21 en casos d’esclerosi lateral amiotròfica

Neurogenètica: La immensa majoria de casos d’esclerosi lateral amiotròfica (ELA) són espontanis. No obstant, entre un 5% i un 10% dels casos d’ELA tenen un historial previ a la família. Aquests casos familiars han permès identificar tota una sèrie de gens mutacions dels quals hi són al darrera. Ara bé, hi ha un 30% de casos familiars d’ELA pels quals no s’ha identificat mutacions en aquesta llista de gens. El neuròleg Ricard Rojas-García, de la Unitat de Malalties Neuromusculars de l’Hospital de Sant Pau de Barcelona, ha coordinat una recerca que amplia aquesta llista amb l’addició del gen ARPP21. En un article al Journal of Neurology, Neurosurgery & Psychiatry, amb el biòleg Oriol Dols-Icardo com a primer autor, expliquen que el punt de partida d’aquesta descoberta fou l’alta incidència d’ELA que es registra a La Rioja Baja. Aquesta alta incidència d’ELA a la Rioja Baja és també de casos esporàdics, però sobretot de casos familiars. Dols-Icardo et al. realitzaren una seqüenciació genòmica completa de dotze pacients amb ELA, dels quals set corresponien a casos sense antecedents familiars, i cinc a casos familiars. L’estudi genòmic fou ampliat després a familiars afectats i a altres afectats de la zona. En un total de 10 pacients amb ELA, pertanyents a set famílies diferents, trobaren la mateixa mutació: el canvi C>T en la posició 1586 gel gen ARPP21. Aquesta mutació genètica comporta la substitució de la prolina de la posició 529 de la proteïna ARPP21 per una leucina. Les sigles ARPP21 fan referència a la fosfoproteïna regulada per AMP cíclic número 21, la qual alhora és una proteïna d’unió a ARN. En els pacients estudiats no trobaren cap mutació en gens relacionats amb l’ELA. Dols-Icardo et al. recorden que en estudis previs s’havia descartat un rol causal de l’ARPP21 en l’ELA, però ells pensen que sí cal incloure aquest gen en la llista de gens causals d’ELA, la qual cosa és rellevant per aprofundir en la patologia molecular d’aquesta malaltia degenerativa que roman sense tractament efectiu.

L’estudi de set famílies de la Rioja Baja amb la mutació p.Pro529Leu de la ARPP21 ha permès explicar a Dols-Icardo per què en aquesta regió hi ha una incidència especialment alta d’esclerosi lateral amiotròfica

L’esclerosi lateral amiotròfica

L’esclerosi lateral amiotròfica (ELA) és una malaltia motoneuronal devastadora. La degeneració de motoneurones superiors i inferiors comporta feblesa i atròfia muscular. Eventualment això condueix a una insuficiència respiratòria. Des de l’inici de la malaltia l’esperança de vida es redueix a 3-5 anys. Dades clíniques, genètiques i neuropatològiques indiquen una connexió entre l’ELA i la demència frontotemporal (FTD).

La majoria de casos d’ELA són esporàdics, en el sentit que no hi ha antecedents familiars. No obstant, entre un 5% i un 10% dels casos d’ELA tenen un historial familiar previ. Vora un 70% dels casos familiars són atribuïbles a una mutació en un dels quaranta gens relacionats amb l’ELA. Tot sovint, aquestes mutacions tenen un patró d’herència mendeliana autosòmic i dominant. Entre els gens relacionats amb l’ELA destaquen els que codifiquen proteïnes d’unió a l’ARN, com és el cas dels gens TDP-43, FUS i TIA1.

La llista de gens relacionats amb l’ELA s’amplia a cada descoberta, però encara hi ha un 30% de casos familiars d’ELA que romanen sense diagnòstic genètic. Per reduir aquesta xifra hom treballa en models que transcendeixen l’herència mendeliana monogènica, i treballen amb uns pocs gens (oligogènics) o amb molts (poligènics).

Encara que una base genètica concreta afecti únicament una petita fracció de casos d’ELA, elucidar-la pot acabar en benefici per a tots els casos. Aconseguir un model precís de la patologia molecular de l’ELA podria ajudar a dissenyar teràpies proteiques i gèniques, d’aplicació general o bé personalitzada.

La taxa d’incidència d’ELA en les poblacions europees i americanes se situa entre 2-3 casos anuals per cada 100.000 habitants. Aquesta taxa és relativament uniforme, de manera que un pic regional d’incidència és sospitós d’amagar casos familiars d’ELA.

Aquest és el cas de la Rioja Baja on, a més, es diagnosticaren casos familiars d’ELA. Dols-Icardo et al. ho atribueixen a una mutació en el gen ARPP21. Així, ARPP21 seria una més de les proteïnes d’unió a ARN que causen ELA. De moment la mutació ha estat trobada en 10 pacients de 7 famílies diferents.

Una alta incidència d’ELA a la Rioja Baja

La Clínica de Malaltia de Neurona Motora de la Unitat de Malalties Neuromusculars de l’Hospital de Sant Pau de Barcelona fa part d’un centre nacional de referència. El reu registre prospectiu de casos d’ELA vistos per la Clínica remunta al 1998. Entre el 2009 i el 2022 aquest registre assenyala un nombre de casos inusualment alt d’ELA procedents d’una petita regió de La Rioja, una fracció dels quals són casos familiars. En total en aquest període i en aquesta regió visitaren 15 casos d’ELA, dels quals 7 eren casos familiars d’ELA.

Des de l’Hospital de Sant Pau es contactà amb els departaments de neurologia dels centres d’aquesta regió. Com a població elegible es determinaren els casos nous diagnosticats d’ELA en la regió que havien estat visitats entre el gener del 2009 i el desembre del 2022. Per a l’anàlisi genètica se seleccionaren els casos dels quals hom disposava de mostres d’ADN.

Les dades demogràfiques considerades eren el sexe, la data i lloc de naixement, i el lloc d’origen de la família. Les variables clíniques considerades eren l’edat en l’aparició de la malaltia, la durada de la malaltia, la regió d’aparició de símptomes motors (espinal o bulbar), el fenotip clínic (esclerosi lateral primària i/o atròfia muscular progressiva), la presència de trastorns cognitius i/o comportamentuals (inclosa la FTD).

L’historial familiar es recollia en l’avaluació clínica rutinària. Es registraven també trastorns cognitius apareguts abans dels 65 anys.

La seqüenciació genòmica completa es realitzà al Centre Nacional d’Anàlisi Genòmica de Barcelona, en un instrument NovaSeq 6000 amb protocol Illumina. Les lectures de seqüència eren cartografiades en el genoma humà GRCh38.

Dols-Icardo et al. presenten els resultats d’una seqüenciació genòmica completa de 12 d’aquests pacients d’ELA, dels quals 7 són casos esporàdics i 5 són casos familiars. Els pacients complien els criteris revisats d’ELA d’El Escorial pel que fa a casos probables, probables amb prova de laboratori i definitius d’ELA. Com a casos familiars es consideraven aquells que tenien un antecedent de diagnòstic d’ELA en un parent de primer o segon grau de consanguinitat, o bé si un parent de primer grau havia rebut un diagnòstic confirmat de FTD. Tots els pacients passaren prèviament per un panell dirigit de gens causants d’ELA, i els que donaren positiu ja no entraren en la seqüenciació genòmica completa. Aquest estudi detectà una mutació en el gen ARPP21, que era present en 1 dels casos esporàdics i en 3 dels casos familiars.

La freqüència d’aquesta mutació del gen ARPP21 fou avaluada en la població espanyola a partir de la base de dades exòmica del Collaborative Spanish Variant Server, que inclou exomes i genomes de 2105 espanyols no relacionats entre ells.

Dols-Icardo et al. procediren a una expansió de l’anàlisi. En aquesta fase es feren seqüenciacions pel mètode de Sanger a 22 individus, amb els encebadors 5’ GACAGTGGTGTGCATCTTGTG 3’ i 3’ GAGACATTCGCACATACCCC 5’. La mutació ARPP21 era present en 10 individus, dels quals 9 eren casos familiars d’ELA. Aquests 10 individus pertanyen a 7 famílies no relacionades entre elles. La seqüenciació exòmica posà de manifest que en aquests 10 individus no hi havia mutacions en altres 58 gens relacionats amb ELA o FTD.

Amb el programari Somalier s’analitzà el grau de parentiu dels individus inclosos en l’estudi.

Els quatre portadors de la mutació amb dades genòmiques completes compartirien un haplotip comú.

D’acord amb la Declaració de Helsinki, tots els participants donaren un consentiment informat previ a la participació en l’estudi.

Epidemiologia d’una mutació

La Rioja Baja és la part sud-oriental de La Rioja, amb una superfície de 1219,42 km2. Entre el 2009 i el 2022 la població mitjana d’aquesta regió era de 43.433 habitants, dels quals 31.324 eren majors de 18 anys. La densitat de població és de 35,62 habitants per quilòmetre quadrat.

Si hom assum una incidència mitjana d’ELA d’1,4 a 2,47 casos anuals d’ELA per 100.000 habitants, hom esperaria que a la Rioja Baja se’n diagnostiquessin entre el 2009 i el 2022 entre 5 i 10 pacients. Com que els casos familiars d’ELA suposen entre un 5% i un 10% dels casos totals, a la Rioja Baja hom en diagnosticaria un cas familiar cada 12,5-50 anys.

En realitat, però, entre el 2009 i el 2022, foren visitats 15 pacients de l’àrea d’estudi que foren diagnosticats d’ELA. D’aquests quasi la meitat (7, 46,6%) tenien un historial familiar d’ELA. En aquests set pacients no es detectà cap de les mutacions conegudes que causen ELA familiar.

Així doncs, la ratio entre casos observats i esperats és de 1,5-2,6 per a l’ELA i de 7-24,5 per a l’ELA familiar.

Dels 15 pacients, 12 eren elegibles per a una anàlisi genòmica ulterior. Un dels pacients fou exclòs quan hom trobà la mutació patogènica c.3107C>G; p.Ser1036X—NM_001199397.3 en el gen NEK1. Dels altres dos pacients no hi havia mostra d’ADN.

Els 12 pacients investigats no tenien parentiu entre ells (cosa confirmada en l’estudi genètic). En 1 dels 7 pacients d’ELA esporàdica i en 3 dels 5 amb ELA familiar es trobà la mateixa mutació en el gen ARPP21: c.1586C>T; p.Pro529Leu (NM_001385486.1 o ENST00000417925.5). La predicció molecular és que aquesta mutació perjudiqui la funció de la proteïna ARPP21. La pressió selectiva contra aquesta mutació d’estima en una puntuació GERP de 6,07.

Aquesta mutació és present en tan sols 4 dels 1.384.130 cromosomes de gnomAD V.4.0.0. No és present entre els 2105 d’individus del Collaborative Spanish Variant Server.

Els quatre portadors de la mutació tenen un haplotip comú, consistent en 442 SNPs que abasten 256 Kb de la regió 35605944–35862077 del cromosoma 3. L’haplotip també és present en vuit de no-portadors de la mutació inclosos en l’estudi. La freqüència de l’haplotip en la població ibèrica d’Espanya és del 7,48%: la freqüència és encara superior entre els britànics (11,5%).

L’ampliació de l’anàlisi a membres de famílies dels portadors de la mutació i altres pacients amb ELA de la regió es va fer pel mètode de Sanger. Així es detectà la mutació en sis persones: 1 parent afectat de la família 2 i 5 casos d’ELA addicionals de 4 famílies diferents. D’aquesta manera la mutació s’ha detectat en 10 persones de 7 famílies diferents.

Dels 10 pacients amb la mutació 5 eren homes. L’edat mitjana d’aparició de la malaltia era de 59,5 ± 11,37 anys, i la durada mitjana de la malaltia era de 16 mesos. Actualment, tan sols sobreviuen 3 pacients. En 8 dels pacients l’aparició era espinal, i en 2 bulbar. En tots els pacients hi havia un fenotip clàssic, amb presència de signes motoneuronals superiors i inferiors. En 1 dels 10 pacients hi havia problemes cognitius-comportamentuals.

Dels 10 pacients, tan sols 1 no presentava historial familiar d’ELA, però fins i tot en aquest cas tenia un germà petit que havia patit demència abans dels 65 anys. En les famílies 5 i 7 també hi ha casos de demència abans del 65 anys.

Set famílies

La família 1 era la del proband II.1. El proband II.1 havia presentat paraparesi progressiva abans dels 50, amb signes motoneuronals superiors difusos. Un germà petit, II.4, havia mort d’ELA en la trentena. II.1 va morir d’insuficiència respiratòria 13 mesos després del diagnòstic.

La família 2 era la del proband III.1. El proband III.1 fou diagnosticat abans d’ELA. El precedent d’ELA era el del seu avi patern, I.1, i el de tres ties, II.2, II.6 i II.8. III.1 va morir 16 mesos després del diagnòstic. Posteriorment el seu cosí III.3 fou diagnosticat d’ELA i també porta la mutació en el gen ARPP21.

La família 3 era la del proband II.2, diagnosticat d’ELA abans dels 70 i que encara viu. Tenia un germà II.4 que havia mort d’ELA.

La família 4 era la del proband II.1, amb un ELA de 3 anys acompanyat d’alteracions comportamentuals i cognitives. Un germà petit II.2 havia estat diagnosticat de demència abans del 65 anys. Els pares havien mort abans de 60 anys. Un germà petit, II.3, no presentava la mutació ni tampoc signes de malaltia motoneuronal.

La família 5 era la del proband III.11, que va morir d’ELA a 16 mesos del diagnòstic. En la família hi havia 7 casos d’ELA.

La família 6 era la del proband III.3, que encara viu. Hi havia dos casos més d’ELA, III.2 i II.2.

La família 7 era la del proband III.3, que morí 4 mesos després del diagnòstic per insuficiència respiratòria. El seu germà III.2 havia mort d’ELA 10 anys abans. Un cosí III.5 fou diagnosticat de demència abans de 60 anys. El seu pare havia mort de càncer pancreàtic en la setantena.

Els pacients amb la mutació p.Pro529Leu tenen una supervivència mitjana de 16 mesos, notablement inferior de l’habitual. Les característiques clíniques, però, són semblants. Aquesta mutació també ha estat detectada al Regne Unit en una família afectada per ELA.

Lligams:

- Identification of a pathogenic mutation in ARPP21 in patients with amyotrophic lateral sclerosis. Oriol Dols-Icardo, Álvaro Carbayo, Ivonne Jericó, Olga Blasco-Martínez, Esther Álvarez-Sánchez, Maria Angeles López Pérez, Sara Bernal, Benjamín Rodríguez-Santiago, Ivon Cusco, Janina Turon-Sans, Manuel Cabezas-Torres, Marta Caballero-Ávila, Ana Vesperinas, Laura Llansó, Inmaculada Pagola-Lorz, Laura Torné, Natalia Valle-Tamayo, Laia Muñoz, Sara Rubio-Guerra, Ignacio Illán-Gala, Elena Cortés-Vicente, Ellen Gelpi, Ricard Rojas-García. Journal of Neurology, Neurosurgery & Psychiatry (2024).

diumenge, 30 de juny del 2024

CN-46700, un fòssil infantil de Neandertal de la Cova Negra (Xàtiva)

Paleoantropologia: L’antropòloga experta en otoacústica evolutiva Mercedes Conde-Valverde, professora de la Universidad de Alcalá de Henares, és l’autora corresponsal d’un article aparegut aquesta setmana a la revista Science Advances sobre CN-46700, un fòssil de fragment cranial trobat a la Cova Negra, de Xàtiva, que interpreten com el d’un infant neandertal de 6 anys que aconseguí viure fins a aquesta edat malgrat una patologia congènita de l’orella interna. Aquesta patologia s’associa a la síndrome de Down, i Conde-Valverde et al. atribueixen la supervivència de l’infant a la cura específica que els neandertals tindrien per als individus discapacitats. La bibliografia recull altres casos de cura d’individus discapacitats pels neandertals, bé per condicions congènites o adquirides. Els casos més coneguts s’associen a individus adults víctimes de traumatismes i alguns autors atribueixen la cura a l’expectativa de reciprocitat. Però hi ha altres casos en els quals la reciprocitat ja no seria possible, i en els quals podria jugar un sentiment de compassió en el marc d’un comportament prosocial que sí seria adaptatiu. Casos de cura a infants amb severes patologies són els que més s’aparten de l’expectativa de reciprocitat. CN-46700 reflecteix, com s’ha dit, una patologia congènita de l’orella interna que probablement era una condició debilitant. La cura específica d’aquest infant s’hauria perllongat durant un mínim de sis anys i en ella haurien d’haver participat, a banda de la mare, altres individus del grup.

CN-46700 és el fòssil d’un fragment de la regió dreta petromastoidea d’un os cranial temporal immadur

La cura com a manifestació d’un context social complex

El fòssil CN-46700 correspon a un infant d’Homo neandertalensis que hauria aconseguit sobreviure fins a un mínim de sis anys d’edat malgrat patir una patologia severa de l’orella interna. El més probable és que aquesta patologia s’associés a la trisomia del cromosoma 21 o síndrome de Down. La patologia de l’orella interna inclouria, com a mínim, una pèrdua severa de l’audició i una reducció marcada del sentit de l’equilibri. Conde-Valverde et al. pensen que l’esforç de cura hauria depassat probablement les capacitats de la mare i requerit l’assistència d’altres membres del grup social.

Val a dir que inferir d’evidències paleopatològiques l’existència d’una cura és arriscat. Conde-Valverde et al., però, defensen que és possible seguir una cadena sistemàtica d’inferència de la paleopatologia a la cura. Una vegada establerta la cura apareix la qüestió de les raons socials d’aquest comportament, que poden anar d’un egoisme recíproc (‘curo perquè em curin o perquè m’han curat’) fins a un sentiment genuí de compassió. Aquest sentiment de compassió podria explicar-se, d’altra banda, com un component d’un comportament col·laboratiu d’alt valor adaptatiu: el comportament prosocial afavoreix la supervivència del grup. En el cas dels infants amb discapacitats la cura seria la manifestació d’una cria col·laborativa més enllà de la mare.

CN-46700 és el primer cas conegut de fòssil d’infant de Neandertal amb signes d’haver patit una patologia congènita severa.

Cova Negra

La Cova Negra de Xàtiva en una imatge del 1928

La Cova Negra és un jaciment de Xàtiva que ha estat objecte de diverses campanyes d’excavació entre el 1929 i el 2017. S’hi han trobat fòssils humans en diferents nivells, els quals han estat datats per ressonància electroparamagnètica (ESR) i sèries d’urani amb una antiguitat d’entre 146.000 i 273.000 anys. Aquests fòssils han estat assignats a l’Homo neanderthalensis.

Recentment, mentre s’examinaven restes fòssils trobades en la campanya del 1989, s’hi trobaren entre aquestes tres fragments que corresponien a restes humanes. Aquests fragments foren excavats en el seu moment d’un nivell que contenia en un 77,2% materials arqueològics corresponents al Paleolític Mitjà i en un 22,7% materials del Paleolític Superior. Això és indici d’una pertorbació que impedeix una datació unívoca del nivell.

Entre els tres fragments hi ha CN-46700, que es correspon a una part de la regió petromastoidea dreta d’un os temporal immadur.

El diagnòstic taxonòmic

Com que CN-46700 fou trobat en un nivell que ha patit pertorbacions estratigràfiques, amb barreja de materials arqueològics del Paleolític Mitjà (l’època típica dels neandertals) i del Paleolític Superior (l’època típica dels cromanyons), cal determinar si pertany a H. neanderthalensis o a H. sapiens. Conde-Valverde et al. escanejaren el fòssil per microtomografria computeritzada. Aconseguiren així un model tridimensional sobre el qual fer-hi mesures i anàlisis anatòmiques. Obtingueren així una imatge que modelitzava l’orella interna de CN-46700.

Hi ha sis característiques diagnòstiques de l’orella interna que permeten diferenciar l’home de Neandertal de l’home anatòmica modern:
- la posició relativa del canal semicircular posterior.
- el radi del canal semicircular anterior.
- el radi del canal semicircular posterior.
- el radi del canal semicircular lateral.
- el nombre total de girs coclears.
- la longitud del tercer gir coclear.

El volum coclear de CN-46700 és anormalment reduït, la qual cosa pot afectar el nombre i longitud dels girs coclears. Conde-Valverde et al. han examinat una mostra d’humans moderns actuals pel que fa a la correlació entre el volum coclear i aquests paràmetres. Han trobat que no hi ha correlació entre el volum coclear i el nombre de girs (r = 0,1341, P = 0,480), ni tampoc entre el volum coclear i la longitud del tercer gir (r = 0,0852, P = 0,654).

La posició del canal semicircular posterior de CN-46700 és semblant al de la mitjana de la mostra de Neandertals que utilitzen Conde-Valverde et al., i es troba lluny d’una mostra formada per tres humans moderns i un H. sapiens fòssil. El nombre de girs coclears i la longitud del tercer gir de CN-46700 entra dins del rang de variació dels neandertals i queda fora del rang d’H. sapiens.

Conde-Valverde et al. han fet una anàlisi de funció discriminant per als paràmetres de canals semicirculars d’una mostra formada per 29 neandertals, 24 H. sapiens fòssils, i 26 H. sapiens actuals. L’anàlisi discriminant permet distingir entre neandertals i sapiens en gairebé tots els casos. CN-46700 es pot assignar segons aquesta anàlisi a H. neanderthalensis amb una probabilitat del 94% .

L’edat de mort de CN-46700

La fossa subarcuada de CN-46700 és esborrada, i s’observa la presència d’un canal petromastoideu. En les poblacions humanes modernes aquesta situació anatòmica es produeix en l’interval de 2 a 5 anys d’edat.

El canal petromastoideu de CN-46700 és d’una amplada de 0,29 mm. Aquestes dimensions són pròpies, en les poblacions humanes modernes, d’una edat de 6 anys.

Rosas et al. (2017) han determinat a partir del fòssil de l’infant de neandertal d’El Sidrón J1 que la taxa de creixement dels neandertals no era gaire diferents dels humans moderns. Per això Conde-Valverde et al., pensen que CN-46700 tindria una edat mínima de 6 anys en el moment de la mort.

Senyals patològics

La microtomografia computeritzada mostra que CN-46700 té una dilatació anòmala del canal semicircular lateral, especialment marcada en la vora no-ampul·lar. La dilatació afecta tot l’arc del canal i fa que l’illa òssia sigui de dimensions reduïdes alhora que augmenta l’àrea transversal al llarg de tot el canal semicircular lateral. Els valors anatòmics deixen CN-46700 fora del rang de variació de la mostra de neandertals abans esmentada. Així doncs, podem parlar d’una displàsia del canal semicircular lateral.

El canal semicircular anterior de CN-46700 mostra també una reducció de l’illa òssia, per bé que sense un augment de la secció transversal de la llum del canal. Això és indicatiu d’una hipoplàsia de l’illa òssia del canal semicircular anterior.

El canal semicircular posterior de CN-46700 té unes dimensions similars a les d’altres neandertals estudiats.

En poblacions humanes modernes, la displàsia de canal semicircular lateral s’acompanya sovint d’altres malformacions de l’orella interna. La més habitual és l’engrandiment de l’aqüeducte vestibular. En el cas de CN-46700 l’aqüeducte vestibular és molt més gran que el d’altres neandertals.

En CN-46700 s’observa una fístula que comunica el canal semicircular posterior amb l’aqüeducte vestibular. En humans moderns la causa més habitual d’aquest tipus de fístules és una otitis media aguda acompanyada de labirintitis.

En humans moderns la displàsia de canals semicircular lateral s’acompanya sovint d’altres alteracions de la còclea i del vestíbul. Així, sol haver-hi una reducció de la mida general de la còclea. També pot haver-hi absència de modiolus, condició que rep el nom de malformació de Mondini. En CN-46700 no hi ha malformació de Mondini, però sí un volum coclear reduït, força menor al rang dels neandertals.

En humans moderns la displàsia de canal semicircular lateral s’acompanya habitualment d’un augment de la mida del vestíbul. En alguns altres casos, per contra, hi ha una disminució de la mida del vestíbul. El vestíbul de CN-46700 és inferior al rang dels neandertals.

En humans moderns la displàsia de canal semicircular lateral es pot associar amb una estenosi del canal coclear o amb alternacions en la via del nervi facial. El canal coclear de CN-46700 entra dins del rang dels neandertals. La via del nervi facial de CN-46700 també entra dins d’aquest rang.

En les poblacions humanes modernes la displàsia de canal semicircular lateral és la malaltia congènita de l’orella interna més habitual. En alguns casos no hi ha cap símptoma extern. El més habitual, però, és que s’acompanyi d’una pèrdua d’audició, bé per causes sensorineurals o per una combinació de causes sensorineurals i conductives. També és habitual que hi hagi símptomes vestibulars com ara la pèrdua d’equilibri o un vertigen sever.

En les poblacions humanes modernes també hi ha casos congènits d’hiperplàsia d’aqüeducte vestibular. Aquests casos poden arnar associats a altres trastorns de l’orella interna o d’estructures adjacents. La hiperplàsia d’aqüeducte vestibular sempre s’associa amb una pèrdua d’audició sensorineural i amb símptomes vestibulars.

En poblacions humanes modernes hom troba casos de comunicacions anormals entre el canal semicircular posterior i l’aqüeducte vestibular. Aquests casos produeixe símptomes vestibulars com la síndrome de la tercera finestra o el fenomen de Tullio. Sorolls forts o canvis de pressió atmosfèrica desencadenen vertigen entre els qui ho pareixen.

A jutjar per això, Conde-Valverde et al. pensen que CN-46700 patia d’una minva servera d’audició i de crisis freqüents i agudes de vertigen i desequilibri incapacitants.

La supervivència de CN-46700 fins a 6 anys d’edat

CN-46700 patia un síndrome caracteritzat per una displàsia de canal semicircular lateral i un engrandiment de l’aqüeducte vestibular. En poblacions humanes modernes això ho trobem en la síndrome CHARGE, la síndrome de Pendred, la síndrome branquio-otorrenal, la síndrome de Waanderburg, la síndrome d’Allagile i la síndrome de Down.

La síndrome CHARGE es caracteritza habitualment per una aplàsia dels canals semicirculars. En CN-46700 hi ha presència de tots tres canals semicirculars, de manera que no seria el seu cas.

La síndrome de Waanderburg es caracteritza per l’aplàsia d’un dels tres canals semicirculars i per un engrandiment del vestíbul. Tampoc no és el cas de CN-46700.

La síndrome d’Alagille inclou l’agènesi parcial o total del canal semicircular posterior. No és el cas de CN-46700, que presenta un canal semicircular posterior normal.

La síndrome de Pendred inclou la malformació de Modini. No és el cas de CN-46700, que presenta un modiolus normal.

La síndrome branquio-otorrenal afecta el canal del nervi coclear i la via del nervi facial. Tampoc no és el cas de CN-46700.

Així doncs, només quedaria la síndrome de Down. En la síndrome de Down és habitual la displàsia del canal semicircular lateral, de vegades acompanyada d’un engrandiment de l’aqüeducte vestibular. També és habitual la hipoplàsia de canal semicircular anterior i una mida petita de la còclea. La displàsia de canal semicircular lateral acompanyada d’una reducció del vestíbul s’ha reportat en individus amb síndrome de Down.

En les poblacions humanes actuals, la síndrome de Down és la malaltia genètica més habitual. La base cromosòmica és la trisomia del cromosoma 21, la qual s’ha reportat en altres espècies de grans simis com ara els ximpanzés.

La síndrome de Down, a banda de malformacions de l’orella interna, afecta el creixement i el desenvolupament físic i cognitiu. Totes les fases del desenvolupament ontogènic hi són afectades, amb retard en l’adquisició de la capacitat de caminar, de la capacitat de parlar, etc. Hi ha dificultats en l’aprenentatge instrumental i en l’adquisició d’habilitats comunicatives i socials. En més del 80% dels infants amb síndrome de Down hi ha hipotonia generalitzada, cosa que es manifesta ja en el període lactant amb poca força de succió. El retard en la psicomotricitat en la síndrome de Down respon a la hipotonia generalitzada, a la hiperlaxitud de lligaments, a un pobre control postural i a problemes d’equilibri. El retard en el desenvolupament motor fa que comencin a caminar més tard, i que ho facin amb menys coordinació motora i equilibri: l’augment del risc de caigudes interfereix en l’aprenentatge exploratori.

En infants amb síndrome de Down hi ha un retard en la dentició i en creixement esquelètic general. Així doncs, les característiques òssies que porten a atribuir a CN-46700 una edat de sis anys poden en realitat respondre a una edat superior.

Matsumoto et al. (2016) reportaren el cas d’un infant de ximpanzé (Pan troglodytes schewinfurthii) del grup M del Parc Nacional de les Muntanyes de Mahale que presentava símptomes semblants a la síndrome de Down. Aquest petit ximpanzé es morí a 23 mesos d’edat, i si aconseguí sobreviure a tal edat fou gràcies a la cura rebuda per part de la seva mare i d’una germana gran. De fet, fou quan la germana gran deixà d’ajudar a la mare que l’infant de ximpanzé morí.

Recentment, Rohrlach et al. (2024) han examinat 10.000 genomes humans antics a la recerca de trisomies, trobant-hi proves clares de sis casos de trisomia 21 i un cas de trisomia 18. Els casos de síndrome de Down (que anaven de l’any 3629 a.C. al 400 a.C.) es corresponien tots a infants que no havien passat dels 16 mesos d’edat.

Conde-Valverde et al. pensen que si CN-46700 aconseguí viure un mínim de 6 anys fou gràcies a una cura i atenció continuades. Recorden que l’esperança de vida d’infants amb síndrome de Down en el 1929 era de 9 anys; que en els anys 1940 tot just havia pujat a 12 anys; i que en l’actualitat en els països desenvolupats supera els 60 anys.

L’estil de vida dels neandertals es caracteritza per una alta mobilitat. Fins i tot la cura altricial normal patia dificultats. Conde-Valverde creuen que no és possible que CN-46700 sobrevisqués aquests sis anys amb la cura única de la mare, si aquesta havia de realitzar també altres activitats quotidianes. La mare hauria d’haver comptat amb l’ajut d’altres membres del grup social, bé ajudant-la o substituint-la en diferents tasques quotidianes generals, o bé ajudant-la directament en la cura de l’infant.

Spoor et al. (1998) reportaren en una calvària de Singa (Sudan), datada en més de 130.000 anys d’antiguitat, una patologia en l’os temporal que reflectiria una minva d’audició i d’equilibri. Coutinho-Nogueria et al. (2022) reportaren en l’espècimen Dar-es-Soltane II H5, trobat al Marroc, i d’una antiguitat de 100.000 anys, una ossificació de laberint amb pèrdua d’audició i d’equilibri. En aquests dos casos la patologia no era congènita sinó adquirida, i la cura del grup davant de la discapacitat podria respondre a criteris de reciprocitat passada i a l’expectativa que podrien tornar el favor si eventualment guarien.

Conde-Valverde et al. pensen que el grup social de CN-46700 sabia perfectament que aquest no podria respondre recíprocament a la cura rebuda. Coqueugniot et al. (2014) interpretaren Qafzeh 11 com la resta d’un H. sapiens de 12-13 anys d’edat de la Galilea de fa 90.000-100.000 anys que sobrevisqué a un traumatisme cranial amb seqüeles neurològics gràcies a la cura del grup. Gracia et al. (2009) reportaren en el Crani 14 de la Sima de los Huesos una craniosinostosi congènita o traumàtica en la que cura grupal hauria estat necessària.

Conde-Valverde et al. pensen que la cura rebuda per CN-46700 respondria a comportaments prosocials de cria compartida. Aventuren la possibilitat que un comportament així ja podria ser present en els ancestres comuns d’H. neanderthalensis i H. sapiens de fa 700.000 anys.

Lligams:

- The child who lived: Down syndrome among Neanderthals?. Mercedes Conde-Valverde, Amara Quirós-Sánchez, Julia Diez-Valero, Nieves Mata-Castro, Alfredo García-Fernández, Rolf Quam, José Miguel Carretero, Rebeca García-González, Laura Rodríguez, Ángeles Sánchez-Andrés, Juan Luis Arsuaga, Ignacio Martínez, Valentín Villaverde. Science Advances (2024).

diumenge, 23 de juny del 2024

‘Lokiceratops rangiformis’ i la riquesa de ceratòpsits en la Montana campaniana de fa 78 milions d’anys

Paleontologia Mark A. Loewen és professor de geologia i geofísica de la Universitat de Utah. Especialitzat en paleontologia de vertebrats, estudia els dinosaures juràssics i cretàcics. Aquesta setmana la revista PeerJ publica un article que ell mateix encapçala en el que es descriu un nou gènere de ceratòpsids centrosaurins, Lokiceratops. L’espècie L. rangiformis ha estat trobada en la Formació del Judith River de Montana, que data del Campanià de fa 78 milions d’anys. Loewen et al. la interpreten com una nova prova de la ràpida radiació regional i la generació d’endemismes entre els dinosaures centrosaurins del període. La planta litoral oriental de Laramídia era el context d’aquests endemismes. L. rangiformis ha estat trobat en la porció inferior de McClelland Ferry, membre de la Judith River Formation, de la regió Kennedy Coulee, situada actualment en la frontera entre Montana i Alberta. Només en aquesta regió hom disposa dades de l’existència de cinc espècies de ceratòpsids, quatre centrosaurins i un quiasmosaurí. Lokiceratops, juntament amb Albertaceratops i Medusaceratops, formaria un clade restringit a una petita porció del nord de Laramídia. Loewe et al. anomenen aquest clade Albertaceratopsini, i el consideren tan sols un dels diversos clades de centrosaurins. Cada clade tindria un rang geogràfic limitat: els Nasutuceratopsini al sud; els Centrosaurini i els Pachyrostra al nord. Aquest alt endemisme regional seria el resultat d’una alta taxa d’especiació i diversificació, impulsada per la competència per recursos, la selecció sexual o els gradients latitudinals de clima i de flora. Loewe et al. pensa, en el context del Cretàcic Tardà de la Nord-Amèrica occidental que hom ha subestimat la diversitat de dinosaures, potser en pensar que els dinosaures tindrien rangs geogràfics comparables als de la megafauna de mamífers del Cenozoic.

El crani muntat de l’espècimen EMK 0012 ha servit per a Loewen et al. en la descripció de ‘Lokiceratops rangiformis’. Aquesta descoberta confirma les ràpides radiacions regionals i l’endemisme extrem dels dinosaures centrosaurins en el territori actual de Montana i Alberta durant l’era Campaniana, fa uns 78 milions d’anys.

El Cretàcic Tardà de l’Interior Occidental d’Amèrica del Nord

Durant el Cretàcic Tardà els ecosistemes de l’interior occidental de l’actual Amèrica del Nord eren dominants per dinosaures. És especialment interessant el període de 13 milions d’anys del Campanià, que va d’una antiguitat de 83 a 70 milions d’anys, interpretat a la llum d’un gradient latitudinal. La regió de Laramídia comptava amb planes al·luvials i costeres en les que la fauna de dinosaures experimentava canvis de composició d’acord amb la latitud. És remarcable la rapidesa amb la qual se succeïen en el temps diferents espècies de megaherbívors. Els ceratòpsids eren per tot arreu, però amb una considerable diversitat morfològica, manifestada en una varietat d’ornaments cranials (banyes, volants parietoescamosals). Fa uns 83 milions d’anys ja havien divergit entre els ceratòpsids d’una banda els quiasmosaurins (de nas i de volants llargs) i de l’altra els centrosaurins (de nas arrodonit i volants curts).

Durant el Campanià els centrosaurins experimentaren una radiació en termes de diversitat i d’importància ecològica. Són abundants les restes a Alberta i a Montana.

Els dipòsits campanians de la Formació Judith River (Montana) i del Grup Belly River (Alberta i Saskatchewan) són testimonis d’una biota terrestre coetània (amb una antiguitat d’entre 79,4 i 75,2 milions d’anys). Entre els grans vertebrats més abundants hi ha ceratòpsids, tan quiasmosaurins com centrosaurins.

Loewen et al. amplien una mica més aquesta diversitat amb la descripció de Lokiceratops rangiformis a partir de les restes relativament completes d’un centrosaurí de la part inferior del Membre McClelland Ferry de la Formació Judith River, a Kennedy Coulee, al nord de Montana. Hauria coexistit amb tres altres espècies de centrosaurins (Wendiceratops pinhornensis, Albertaceratops nesmoi i Medusaceratops lokii) i una de quiasmosaurins (Judiceratops tigris). Lokiceratops seria relativament proper a Albertaceratops i Medusaceratops, cosa explicable si atenem a una ràpida diversificació simpàtrida dins d’un mateix clade. Fins ara hom pensava que l’evolució en els ceratòpsids era essencialment anagènica, en la qual una nova espècie substituïa l’anterior. En una evolució cladogènica i simpàtrida, noves espècies ocupen nínxols ecològics diferenciats, bo i coexistint en la mateixa regió.

La pedrera Loki

L’espècimen que presenten Loewen et al. fou trobat a Loki Quarry, que es troba en terrenys privats dels erms de Kennedy Coulee, al nord de Rudyard (Hill County, Montana). Kennedy Coulee naix precisament en la frontera entre els Estats Units i Canadà, i desemboca al Milk River. En la conca del Milk River trobem afloraments de dipòsits al·luvials campanians. En la descripció d’aquests dipòsits és important la caracterització de vetes de carbó. La regió és de gran interès per a la paleontologia de dinosaures.

Loki Quarry se situa a una altitud sobre el nivell de la mar de 922 metres, i a uns 11,4 metres per damunt de la veta de carbó Marker A (MAC). En aquests 11,4 metres trobem un interval de fang petrificat de riquesa fossilífera, amb vetes carbonàcies. Llits de cendra bentonita situats a 21 metres per sota i 16 metres per damunt de la Loki Quarry han permet una datació per argó-40/39 de 78,5 – 78,2 milions d’anys. Aquesta datació es refermada amb anàlisis d’U-Pb de zirconis de MAC.

La litologia de la Loki Quarry consta de pedres sedimentàries a partir de sorres, llims i fangs rics en material carbonaci. Cal pensar que es formà en un sistema fluvial de drenatge pobre. Les restes vegetals conviden a pensar en una flora rica en Araucariales.

EMK 0012

EMK 0012 és l’esquelet d’un ceratòpsid madur. El va descobrir la primavera del 2019 Mark Eatman, en terres del Wolery Ranch. La propietat va donar permís d’excavació, la qual es realitza l’autumni. El crani fou trobat associat però parcialment desarticulat. En el 2021 EMK 0012 fou adquirit per l’Evolutionsmuseet de Knuthenborg.

El treball de preparació, restauració, muntatge i reconstrucció de l’EMK 0012 fou a càrrec de Fossilogic LLC, amb seu a Pleasant Grove (Utah). Els fragments cranians arribaren embolicats en paper d’alumini, amb dos blocs protegits amb guix i arpillera. Jen Sellers i Estrella Gallegos hi van dedicar setmanes durant l’autumni del 2021. Els motllos de cada peça foren traslladats al Natural History Museum of Utah. Mark Loewen, Joseph Sertich, Savhannah Carpenter i Brock Sisson articularen els elements i feren la reconstrucció craniana. Durant la primavera del 2022 Ben Meredith, Ethan Storrer, Jose Muñoz i Seth Bourgeous feren el treball de muntatge i restauració.

L’anàlisi filogenètica

La posició sistemàtica d’EMK 0012 fou realitzada en una matriu iniciada per Scott Sampson i Catherine Forster en els anys 1990, i que Mark Loewen i Andrew Farke expandiren en les dues primeres dècades del segle XXI. Com a grup extern s’utilitza Hypsilophodon foxii, i com a grup intern hi ha 86 tàxons diferents. La base de dades inclou 377 caràcters: 263 cranials, 61 postcranials i 53 d’ornamentació de volants.

EMK 0012 fou comparat amb una selecció exhaustiva de ceratopsians.

Els actes de nomenclatura

EMK 0012 és classificat en els tàxons següents:
- Dinosauria Owen, 1842, en el sentit de Padian & May, 1993.
- Ornistichia Seeley, 1887, en el sentit de Sereno, 1998.
- Ceratopsia Marsh, 1890, en el sentit de Dodson, 1997.
- Ceratopsidae Marsh, 1888, en el sentit de Sereno, 1998.
- Centrosaurinae Lambe, 1915, en el sentit de Dodson, Forster & Sampson, 2004.
- Albertaceratopsini, com a clade nou. Es defineix per incloure tot els tàxons més estretament relacionats amb Albertaceratops nesmoi que amb Centrosaurus apertus.
- Lokiceratops, gènere nou.
- Lokiceratops rangiformis, espècie nova. El nom de rangiformis fa referència a l’asimetria bilateral de les ornamentacions de volants, que recorden l'asimetria de la cornamenta del ren o caribú Rangifer.

L’holotip de L. rangiformis és EMK 0012, un crani associat i desarticulat amb un esquelet postcranial parcial. Entre els elements postcranials hi ha vèrtebres cervicals, l’escàpula dreta i un coracoide.

Entre les autoapomorfies característiques de L. rangiformis, respecte d’altres centrosaurins, hi ha un nas sense ornament, una epiossificació elongada en pla del marge posterior del volant parietoesquamosal, i una hipertròfia epiparietal en corba lateral en el pla del volant.

La longitud basal del crani de Lokiceratops era de 948 mm.

Les restes trobades d’Albertaceratopsinae es limiten a un rang geogràfic de no pas més de 490 km2 (nord de Montana i sud d’Alberta), corresponent a una franja de 25 km d’amplada de la península de Laramídia, a una latitud de 55ºN. El rang temporal de cada espècie devia ser d’entre 200.000 i 500.000 anys.

Lligams:

- Lokiceratops rangiformis gen. et sp. nov. (Ceratopsidae: Centrosaurinae) from the Campanian Judith River Formation of Montana reveals rapid regional radiations and extreme endemism within centrosaurine dinosaurs. Mark A. Loewen, Joseph J. W. Sertich, Scott Sampson, Jingmai K. O’Connor, Savhannah Carpenter, Brock Sisson, Anna Øhlenschlæger, Andrew A. Farke, Peter J. Makovicky, Nick Longrich, David C. Evans. PeerJ 12: e17224 (2024).

dissabte, 22 de juny del 2024

L’erosió per onades a les costes de Tità

Geomorfologia comparada: Si fa deu dies parlàvem del cicle de l’aigua a Mart en referència a gebrades matinals dalt dels volcans més alts del Sistema Solar, avui parlàrem de les onades al llac de Tità. No es tracta, és clar, de res a veure amb el cicle de l’aigua, car els llacs de Tità no són fets d’aigua. Són, de fet, mars d’hidrocarburs. Des del punt de vista geomorfològic, aquests hidrocarburs a Tità fan el rol de líquid capaç d’excavar al llarg del temps valls fluvials. La geomorfòloga Rose V. Palermo, en tant que experta en sistemes litorals, ha liderat una recerca per aclarir si a Tità hi ha fenòmens d’erosió costanera anàlegs als que trobem a la Terra. En un article publicat a Science Advances, Parlemo et al. expliquen els senyals d’erosió per onades que han trobat en les costes de Tità. Val a dir que les observacions fetes per sondes com la Cassini-Huygens i els models teòrics ja indicaven que l’atmosfera de Tità és prou densa i dinàmica com perquè s’hi formin vents que facin alçar onades als llacs i mars del planeta, resultant en un fenomen d’erosió litoral. Per desgràcia hom no disposa d’imatges i dades prou detallades sobre l’evolució del litoral a Tità al llarg dels anys. Per acabar-ho d’adobar ni tan sols a la Terra hom disposa d’un marc teòric universalment acceptat que tradueixi la morfologia observable del litoral en mecanismes d’erosió costanera: i això que a la Terra onades i marees són ben conegudes i la geormorfologia del litoral seguida amb atenció. En aquest treball, Palermo et al. han combinat models d’evolució del paisatge amb mesures de la forma de la línia costera a la Terra: així poden caracteritzar com diferents mecanismes d’erosió litoral es manifesten geomorfològicament. En aplicar aquest marc teòric a les imatges que hom té de Tità, Parlermo et al. troben que les línies costaneres d’aquest planeta satèl·lit de Saturn són sobretot consistents amb paisatges que, un cop inundats, han patit els efectes d’onades, i no pas tant amb paisatges sotmesos a un procés erosiu uniforme o sense erosió costanera. En aquests models el creixement de les onades satura a distàncies de l’ordre de miriàmetres.

Els litorals queden marcats segons si pateixen predominantment un procés erosiu uniforme, per onades o per rius. A la Terra, trobem exemples de llacs on l’erosió dominant és uniforme (Kozjak Jezero, a Croàcia), amb poca influència d’onades i de rius. També trobem exemples com el Lake Lanier, als Estats Units, on la principal influència sobre el litoral l’exerceix l’erosió fluvial. En canvi, al Sebago Lake, també als Estats Units, domina l’erosió per onades. Palermo et al. mostren que a Tità els mars (com el Kraken Mare o el Ligeia Mare) s’assemblen més al Sebago Lake que al Lake Lanier o el Kozjak Jezero).

Els rius, llacs i mars de Tità

Tità és la lluna més gran de Saturn i l’onzè dels objectes coneguts del Sistema Solar en termes de massa. La pressió atmosfèrica de Tità és un 48% superior a la de la Terra. De fet, pel que sabem, la Terra i Tità són els únics planetes dels que sabem del cert que hi ha presència permanent de matèria en estat líquid en la superfície. A la Terra aquesta matèria líquida és aigua. A Tità, en canvi, els líquids són hidrocarburs. Si a la Terra hi ha un cicle de l’aigua en el que participen el glaç d’aigua, l’aigua líquida i el vapor d’aigua, a Tità el cicle d’hidrocarburs és alimentat per precipitacions facilitades per la densa atmosfera de metà, i manifestat en forma de rius, llacs i mars. De la mateixa manera que a la Terra hi ha regions climàtiques a diferents latituds, a Tità la major part dels mars d’hidrocarburs es concentren en les regions polars.

P3 - Jezero Kozjak - Plitvička jezera

El llac Kozjak, al planeta Terra. Les onades són massa febles com per influir en la morfologia del litoral

La major part de la superfície de la Terra és coberta per un oceà global. No és el cas de Tità. Els llacs i mars de Tità varien en mida i formes, però els més grans tenen una mida comparable als Grans Llacs d’Amèrica del Nord. Si els llacs de Tità més petits són de perímetres arrodonits, els mars més grans són tan complexos morfològicament com els Grans Llacs d’Amèrica o d’Àfrica.

Els llacs i mars més grans de Tità reben aportacions fluvials. Les desembocadures fluvials hi solen formar estuaris. L’acció erosiva dels rius es manifesta en valls fluvials particularment en pregones en les regions que envolten les mars de Tità.

El cicle ‘hidrològic’ de Tità no es basa en l’aigua sinó en el metà. Una bona part dels hidrocarburs líquids es troben en llacs i mars. Les línies costaneres de llacs i mars poden donar-nos pistes sobre el passat i el present del clima de Tità en tant que reflecteixen la interacció entre els hidrocarburs líquids i el substrat geològic.

Les badies crenulades i amb forma de funel que trobem a les imatges de la NASA Cassini de Ligeia Mare (regió polar boreal de Tità) en els punts on desemboquen rius conviden a pensar que en el passat recent hi ha hagut un augment del nivell de la mar que ha acabat per inundar antigues valls fluvials. Seria un fenomen anàleg a les ries postglacials de la Terra.

A Ontario Lacus, l’únic gran llac de la regió polar austral de Tità no hi ha indicis d’aquestes ries. Això ha fet pensar que Tità pateix, com la Terra, de cicles de Milankovitch, que es manifesten en alteracions en les estacions dels hemisferis nord i sud. En la configuració actual, el nivell de la mar es trobaria en un punt alt a l’hemisferi nord i en un punt baix a l’hemisferi sud.

Les inundacions de valls fluvials en l’hemisferi nord de Tità obeirien a un canvi climàtic que també es manifestaria en la creació i formació per dissolució de petits llacs polars. Als mars més grans hi ha indicis d’erosió mecànica provocada per onades. Al capdavall la combinació d’una pressió atmosfèrica de 1,5 bars i de grans masses de líquid convidarien a la formació d’onades generades per vents. A més, cal recordar que a Tità la gravetat és inferior a la de la Terra (1,352 m·s-2 vs. 9,807 m·s-2), és superior la ratio de densitats entre l’atmosfera i la massa líquida i és menor la tensió superficial dels líquids hidrocarburs respecte la de l’aigua. Les dades de l’espectròmetre VIMS de la NASA Cassini suggereixen que taques isolades de superfícies líquides rugoses són, senzillament, onades. Alguns reflexos especulars que VIMS trobà a Kraken Mare podrien explicar-se per l’efecte d’onades. Imatges pel radar SAR de la NASA Cassini indiquen trets brillants transitoris que podrien ser onades superficials. La costa llarga i llisa del Ontarius Lacus podria explicar-se per processos de deposició dominats per onades.

El problema per acceptar totes aquestes evidències en favor d’onades a Tità és que no hi ha imatges in situ de superfícies líquides. A més les imatges que tenim no cobreixen els 30 anys que dura tot un cicle estacional a Tità. D’altra banda, les onades a Tità tenen en contra indicis teòrics com vents de velocitat lenta, una atmosfera massa densa, uns hidrocarburs líquids massa densos i viscosos i una deposició continuada d’aerosols.

Palermo et al. focalitzen l’atenció en l’erosió litoral, deixant de banda l’efecte que les onades poden generar sobre el transport de sediments. Com a model empren els mecanismes pels quals les onades a la Terra afecten la morfologia de costes rocalloses. Les mars del nord de Tità tenen unes costes retallades que es devien formar després de processos erosius fluvials sobre terrenys muntanyosos, i de la inundació generada per l’augment del nivell marítim. El litoral d’aquestes mars és dominat per plataformes litorals i penya-segats, amb poques o no gens morfologies deposicionals com ara platges. Palermo et al. assumeixen que el sediment generat pels processos erosius o bé no roman a la zona litoral o bé es massa poc abundant com per influir en la línia de costa. Són conscients que aquest criteri no s’aplicaria al Ontario Lacus.

La relació entre mecanismes erosius i morfologia no es troba del tot ben establerta per als llacs de la Terra. Se sap, però, que cada mecanisme pot manifestar-se en diferents dimensions fractals de la morfologia litoral. Descriptors el·líptics de Fourier suggereixen l’existència de quatre grups morfològics entre els llacs del nord de Tità. Palermo et al. contemplen bàsicament dos mecanismes d’erosió litoral: 1) l’erosió dominada per onades; 2) l’erosió uniforme. En el primer cas la taxa erosiva és proporcional al poder de les onades per trencar les roques del litoral. La potència de les onades, en llacs, és superior com és distància puguin recórrer abans d’arribar a la costa. Això explica que hi hagi llenques de costa oberta relativament llises en contrast amb la costa més retallada de les ries.

En l’erosió uniforme actuen processos com la dissolució i el retrocés. Cal recordar que l’escorça de Tità no és feta de roca en el sentit que ho és la de la Terra. L’escorça de Tità consisteix principalment d’aigua glaçada, amb un percentatge considerable d’hidrocarburs sòlids (com el benzè). Els llacs de Tità són fets fonamentalment de metà i età líquids, que poden dissoldre bona part dels hidrocarburs sòlids de l’escorça.

Palermo et al. analitzen tres possibilitats sobre litoral de Tità: 1) que l’erosió sigui dominada per onades; 2) que l’erosió sigui dominada per un procés uniforme (com la dissolució); 3) que no hi hagi erosió. Això es correspon a tres escenaris: 1) paisatges modelats per onades; 2) paisatges modelats per una erosió uniforme; 3) paisatges que han retingut l’estat originari de vall fluvial inundada. Les dades que presenten Palermo et al. afavoreixen la possibilitat 1).

Model d’erosió litoral

Palermo et al. han simulat la incisió fluvial i l’erosió litoral de paisatges sintètics utilitzant el model NEWTS. Les línies inicials de costa foren erosionades al 94% del relleu inicial per reproduir l’erosió fluvial. Seguidament eren inundades de tal manera que les valls fluvials tornaven ries. Les costes resultants eren sotmeses bé a una erosió per onades o a una erosió uniforme fins a augmentar en un 50% la superfície del llac. L’erosió per onades assum un camp de vents isotròpic: la força de les onades depèn de la distància que puguin recórrer abans de trencar.

L’erosió uniforme condueix a l’ampliació del sistema originari de ries, mentre que en l’erosió per onades el sistema de ries es veu reduït. Palermo et al. es fixen en la diferència produïda en la rugositat de la línia litoral i la distància de recorregut de les possibles onades. Aquesta distància depèn de la mida de la conca, i de la distància a la qual saturen les onades (la mida màxima de les tempestes).

Per comprovar la sensibilitat del model, Palermo et al. també han fet simulació d’erosió litoral sota un clima anisotròpic de vents i onades.

Llacs reals de la Terra i de Tità

Palermo et al. comproven la classificació tripartida de llacs del seu model en set llacs de la Terra. A Lake Murray, Lake Lanier i Fort Peck Lake troben una línia de costa compatible amb un paisatge incidit per rius i després inundat, cosa esperable tractant-se d’embassaments artificials: l’erosió posterior juga un paper menor. A Sebago Lake i Lake Rotoehu el litoral ha estat marcat per les onades. A Prošćansko Jezero i Kozjak Jezero, en canvi, el litoral ha estat dominat per un procés d’erosió uniforme: l’erosió dels substrats calcaris en sistemes kàrstics són una bona analogia de la dissolució que els llacs d’hidrocarburs realitzen sobre la fracció hidròfoba de l’escorça de Tità.

Palermo et al. es fixen en tres mars de Tità (Ligeia Mare, Punga Mare i Kraken Mare) i en un llac de Tità (Ontario Lacus). A Ontario Lacus troben un litoral marcat per l’erosió per onades. A les tres mars analitzades domina un litoral sense erosió, però allà on sí hi ha erosió les onades juguen un paper preponderant sobre l’erosió uniforme. Quan Parlermo et al. assumeixen que el recorregut màxim de les onades és de 20 km, el rol de l’erosió per onades sembla més gran per a les tres mars analitzades. Així doncs l’erosió per onades en un context explicaria la morfologia de la línia de costa d’aquests mars.

Lligams:

- Signatures of wave erosion in Titan’s coasts. Rose V. Palermo, Andrew D. Ashton, Jason M. Soderblom, Samuel P. D. Birch, Alexander G. Hayes, J. Taylor Perron. Science Advances (2024)

dimecres, 12 de juny del 2024

Gebrades matinals dalt dels volcans tropicals de Mart

Hidrologia: Parlar de cicle de l’aigua a Mart pot semblar una exageració, particularment si es tracta de latituds temperades. El cas és que a la província volcànica de Tharsis hom ha detectat la presència de vapor d'aigua i de núvols d’aigua gelada. Adomas Valantinas és el primer autor d'un article a Nature Geoscience en el que es posa de manifest l'existència de dipòsits matinals de gebre dalt dels volcans de Tharsis. Això sembla ratificar l’existència de bescanvis d'aigua entre la regolita local i l'atmosfera. És a les calderes dels volcans Olympus, Arsia, Ascraeus i Ceraunius Tholus que Valantinas et al. han detectat extensos dipòsits de gebre matinal transitori amb l’ús d’imatges de color d’alta resolució obtingudes pel Colour and Stereo Surface Imaging System del ESA Trace Gas Orbiter. Són dipòsits blavosos d’unes hores de durada en el sòl i en la vora de la caldera: es formen a la matinada i es desfan al matí durant l’estació més freda. Així doncs, en les imatges vespertines no hi ha rastre d’aquests dipòsits. Les observacions espectrals indiquen la presència d’aigua en aquests dipòsits. Imatges independents del ESA Mars Express Orbiter corroboren que es tracta d’aigua glaçada. D’acord amb simulacions climàtiques, la temperatura a primera hora del matí a les alçades de les calderes és prou baixa com per fer condensar l’aigua, però no prou com per fer condensar el diòxid de carboni: així doncs el gebre seria essencialment d’aigua. Valantinas et al. pensen que el gebre es forma a partir de vapor d’aigua atmosfèric, i no pas de vapor d’aigua d’origen volcànic, d’acord amb la natura estacional del fenomen.

Valantinas et al. han detectat a partir dels instruments CaSSIS, HRSC i NOMAD la presència de gebre en la caldera del Mont Olimp de Mart. Les condicions de microclima permeten la formació, durant l’hivern, de gebre matinal que es desfà a mesura que avança el matí. S’estableix així un cicle circadià de l’aigua entre la regolita i l’atmosfera.

El bony de Tharsis

L’elevació de Tharsis és una gran província volcànica del tròpic de Mart, per bé que s’estén des d’una latitud de 40°N a 40°S, i des d’una longitud de 220°E a 300°E. Es presenta com una cúpula topogràfica que s’alça vora 5 km respecte del terreny que l’envolta. Com que l’extensió de la regió és de 5000 km, el pendent no és extraordinàriament pronunciat. Tot i amb tot, aquesta elevació és la que explica que hi trobem els cims més alts de tot el Sistema Solar. Olympus Mons s’eleva 21 km respecte del nivell mitjà de la superfície marciana; Arsia Mons, uns 18 km; Pavonis Mons, 14 km; Ceraunius Tholus, uns 9 km.

Al llarg de la història de Mart l’activitat volcànica del planeta s’ha concentrat a la regió de Tharsis. Els indicis més recents d’activitat volcànica són fluxos de lava d’una antiguitat de no pas més de 2,4 milions d’anys. Les dades geofísiques assenyalen que Mart és encara un planeta geodinàmicament actiu, per bé que en l’actualitat no es registra activitat volcànica ni a Tharsis ni enlloc del planeta.

L’alçada considerable dels cims de la regió de Tharsis genera unes condicions climàtiques específiques que es manifesten en la formació de núvols orogràfics d’aigua glaçada i en altres fenòmens atmosfèrics. Hom pensa que aquesta aigua glaçada s’origina en les regions polars i acaba per transformar-se en vapor d’aigua a mesura que s’endinsa en les regions equatorials. Tharsis també queda al mig del camí de les cèl·lules de Hadley que es formen durant els solstici, i a través de les quals hi ha una transferència anual d’un miler de milions de tones de vapor d’aigua entre hemisferis.

La concentració atmosfèrica de vapor d’aigua assoleix uns pics locals damunt dels volcans de la regió de Tharsis, cosa que es podria explicar per l’existència d’un bescanvi actiu de vapor d’aigua entre la regolita de la superfície i l’atmosfera. El vapor d’aigua podria provindre de la desorpció de la regolita o de la sublimació de gebre. També podria ser que l’enriquiment local de vapor d’aigua obeís a patrons de circulació local.

De llarg la major part del glaç d’aigua a Mart es concentra en les regions polars. Component menor d’aquesta criosfera és el gebre estacional que es forma en latituds mitjanes i fins i tot baixes. Així la NASA Viking 2 ja va detectar fa quasi mig segle la presència de gebre d’aigua en la zona on aterra, a una latitud de 48°N. Vehicles orbitals han detectat indicis a gebre d’aigua a una latitud de fins a 32°N en l’hemisferi nord, i a una de 13°S en l’hemisferi sud: val a dir que aquest gebre de latitud baixa només es forma en pendents d’obaga.

Si atenem a la temperatura i a la humitat, hom no esperaria trobar gebre en latituds equatorials. Durant les hores nocturnes, si el refredament radiatiu és prou elevat es podria formar gebre a bona part de la superfície planetària. Així doncs, el ròver NASA Opportunity detectà prop de l’equador quantitats petites de gebre.

L’atmosfera marciana consisteix en un 95% de CO2. Si la temperatura es prou baixa es pot formar gebre de CO2, gebre carbònic. En regions equatorials hi hauria una formació circadiana de gebre carbònic durant la nit. Ara bé, tan bon punt surt el Sol, aquest gebre carbònic no duraria ni uns minuts abans de sublimar-se completament. És significatiu que l’instrument THEMIS no hagi detectat en les imatges a color de primera hora del matí d’arreu del planeta indicis de gebre carbònic a les regions equatorials.

El Trace Gas Orbiter (TGO) de l’Agència Espacial Europea (ESA) consta d’un sistema CaSSIS d’obtenció d’imatges estereogràfiques de color de la superfície de Mart. Valantinas et al. hi troben un fort indici de deposició de gebre matinal als volcans equatorials de la regió de Tharsis.

Observacions de gebre

A primera hora del matí (07:11 hora local) del 25 de novembre del 2022 (longitud solar de 345° de l’any marcià 36), CaSSIS fotografiava amb una resolució espacial de 4,5 metres per píxel la caldera de l’Olympus Mons. Aquesta caldera se situa a una latitud de 18.5° N i a una longitud de 133.5° W. Les imatges indicaven la presència de dipòsits blavosos (amb pic a 500 nm de longitud d’ona) en sectors del sòl i de la vora de la caldera. Hi ha una correlació entre la presència d’aquests dipòsits i la topografia. Així, els dipòsits es concentren en el sòl de la caldera, i són absents en els pendents més ben il·luminats, i tampoc no n’hi ha en el flanc del volcà.

Cinc dies després, el 30 de novembre, una imatge de la càmera estereogràfica d’alta resolució (HRSC) obtinguda a l’hora local de les 07:20, i amb una resolució espacial de 800 metres per píxel, es constatava la presència d’un dipòsit en forma d’halo blavós per tot el sòl de la caldera i per tota la vora. Aquest halo és absent en els flancs del volcà, i es concentra tan sols en el cim de la muntanya.

L’espectròmetre NOMAD avaluà aquests dipòsits trobant-hi un elevat valor d’índex de glaç.

Imatges reiterades de HRSC mostren que els dipòsits de gebre al cim de l’Olympus Mons apareixen únicament a primera hora del matí (de 07:00 a 07:30 hora local). El gebre es forma en la unitat geològica d’halo brillant. Aquesta unitat geològica podria ser pols més brillant que el material circundant per raons de mida de gra o de textura. Hom pot aventurar que és un terreny amb una conductivitat termal més baixa, i una emissivitat termal més alta. Aquest terreny es refredaria més durant la nit, i s’escalfaria més lentament durant el matí.

Imatges de CaSSIS indiquen que el gebre també pot condensar a sotavent de petits cràters, potser perquè allà s’hi acumula pols transportat pel vent. Els materials més porosos (i menys compactes) afavoreixen la nucleació de gebre.

Val a dir que també es forma gebre a la vora nord de la caldera de l’Olympus Mons, ja fora de la unitat d’halo brillant, però ací el gebre és més localitzat.

En total a la base de dades de CaSSIS, Valantinas et al. han detectat tretze exemples de gebre. Hi ha deteccions als volcans més grans de Tharsis: Olympus Mons, Ascraeus Mons i Arsia Mons. També n’hi ha al volcà escut més modest de Ceraunius Tholus.

En un cas, a Arsia Mons (situada a una latitud de 8.7° S i a una longitud de 121.1° W), s’observà a una hora local de 08:00 la presència de gebre durant l’hivern austral (longitud solar de 90°). Durant observacions fetes a la primavera austral tardana, no hi ha una línia de gebre a Arsia Mons que separi els pendents d’obaga i de solana.

L’anàlisi fotomètrica mostra que el gebre s’associa amb un augment de la reflectància de fins al 20%. Altres indicis assenyalen que els dipòsits de gebre són en general molt prims.

Les imatges CaSSIS de Olympus i Arsia indiquen tendències circadianes en la deposició de gebre. Encara que no tant marcades, també podria haver tendències estacionals. Les quatre deteccions a Olympus Mons, com s’ha dit es concentren entre les 07:00 i les 07:30, i ho fan en la primavera boreal (longituds solar de 320 a 40°). Les quatre deteccions a Arsia Mons es concentren entre les 07:00 i les 08:30, i al voltant dels solstici hivernal austral (longituds solar de 45 a 145°). L’absència de gebre matinal a Arsia Mons es concentra en el període d’estiu austral.

Gebre d’aigua

El model de circulació general (GCM) i el model WRF serveixen a Valantinas et al. per calcular quina seria la temperatura de superfície en els punts que CaSSIS detecta gebre. La temperatura a Olympus Mons a 07:00 seria de 150 K, i la temperatura d’Arsia Mons a 08:00 seria de 185 K. Serien temperatures massa altes com per a permetre l’estabilitat del gebre carbònic en altituds tan altes (amb baixa pressió atmosfèrica). La temperatura a Olympus Mons seria 10 K massa alta, i a Arsia Mons ho seria 55 K. El punt de gebre per al CO2 és de 162 K, mentre que el punt de gebre per a l’aigua seria de 180 K.

Imatges obtingudes per l’instrument THEMIS del Emirates Mars InfraRed Spectrometer indiquen que en l’època de l’any de 346,7° de longitud solar per a Olympus Mons i de 93,8° de longitud solar per a Arsia Mons, no hi hauria formació de gebre carbònic. El gebre carbònic que es podria formar a Arsia Mons sublimaria en qüestió de pocs minuts després de l’alba.

Un indici contra la formació de gebre carbònic als volcans de Tharsis és l’absència d’estries en els pendents de la caldera. Ara bé, alhora aquesta absència indica que tampoc el gebre d’aigua té un paper rellevant en l’erosió d’aquest paisatge.

El microclima dalt dels volcans de Tharsis

Les simulacions climàtiques indiquen que la topografia dels volcans de la regió de Tharsis tenen un clima peculiar. A les calderes d’Olympus Mons i d’Arsia Mons hi hauria una reducció substancial de la pressió atmosfèrica superficial. Ala caldera d’Olympus Mons la pressió atmosfèrica seria de 110 Pa, mentre que a la base de la muntanya seria de 160 Pa. A la caldera d’Arsia Mons la pressió atmosfèrica seria de 100 Pa, i a la base de 200 Pa. El règim de vents horitzontals a la caldera d’Olympus Mons seria de 10 m/s, mentre que en els flancs de volcà seria de 30 m/s. A la caldera d’Arsia Mons els vents horitzontals bufarien a tan sols 5 m/s, mentre que als flancs seria de 20 m/s.

El gruix dels dipòsits de gebre en aquestes condicions seria de l’ordre d’1-10 μm. Comptant les calderes d’Olympus, Arsia, Ascraeus i Ceraunius, el bescanvi diari de glaç d’aigua seria de 1,5 × 108 kg.

L’origen del vapor d’aigua

Les tretze observacions de gebre per CaSSIS mostren una tendència estacional. Cal pensar que la font d’aigua són canvis estacionals de gran escala, com ara la sublimació del casquet polar oposat i el transport d’aire humid. El cinyell de núvols d’afeli fa un pic a unes longituds solars de 40°–140°, i hi ha poca activitat de núvols a longituds solars de 245°–320°. El Mars Color Imager del Mars Reconnaissance Orbiter ha detectat núvols orogràfiques de vesprada als volcans de la regió de Tharsis. En la regió de Tharsis l’enriquiment estacional de vapor d’aigua es concentra en l’equinocci de primavera boreal (longitud solar de 0°), i aquest enriquiment podria ser la base del gebre matinal. L’enriquiment de vapor d’aigua seria facilitat per vents de gran escala, complementats amb vents locals que pugen amunt pels pendents.

Hom calcula que la reserva estacional de vapor d’aigua a l’atmosfera és de 1000 milions de tones. Els bescanvis a les calderes de Tharsis abasten unes 150.000 tones diàries, quantitativament anecdòtiques, però localment concentrades.

Un origen alternatiu d’aquest vapor d’aigua podria ser volcànic. Els volcans de Mart són adormits, però hom no pot descartar que facin emissions de CO2, vapor d’aigua i diòxid de sofre. Si els gebre matinal té aquest origen, podria ajudar a entendre el vulcanisme marcià.

Lligams:

- Evidence for transient morning water frost deposits on the Tharsis volcanoes of Mars. A. Valantinas, N. Thomas, A. Pommerol, O. Karatekin, L. Ruiz Lozano, C. B. Senel, O. Temel, E. Hauber, D. Tirsch, V. T. Bickel, G. Munaretto, M. Pajola, F. Oliva, F. Schmidt, I. Thomas, A. S. McEwen, M. Almeida, M. Read, V. G. Rangarajan, M. R. El-Maarry, C. Re, F. G. Carrozzo, E. D’Aversa, F. Daerden, B. Ristic, M. R. Patel, G. Bellucci, J. J. Lopez-Moreno, A. C. Vandaele, G. Cremonese. Nature Geoscience (2024)

dimarts, 11 de juny del 2024

Arrenca la 15a Legislatura del Parlament de Catalunya

Ahir tingué lloc la sessió constitutiva del Quinzè Parlament de Catalunya.

La sessió ha arrencat amb la constitució de la mesa d'edat, presidida pel diputat de més edat, 66 anys, Agustí Colomines (Junts+), i amb els diputats més joves com a secretaris, Júlia Calvet (Vox, 23 anys, l'única diputada nascuda al segle XXI) i Mar Besses (ERC, 25 anys). En la seva intervenció, Colomines recordà la seva entrada al Parlament el 1980, a 23 anys, quan era assistent del diputat Josep Benet (elegit pel PSUC però adscrit al Grup Mixt).

La primera controvèrsia de la mesa d'edat ha sorgit arran de les sol·licituds de vot delegat dels diputats. La sol·licitud del diputat Rubén Wagensberg (ERC) delegava el vot en la diputada Marta Vilalta (ERC), i no ha generat debat en al·legar baixa mèdica. Sí que ho han fet les sol·licituds de Carles Puigdemont (Junts+) i Lluís Puig (Junts+), que el delegaven en Albert Batet (Junts+): aquestes delegacions han estat acceptades pels vots de Colomines i Besses, amb el vot en contra de Calvet. El Tribunal Constitucional s'havia pronunciat recentment en contra de les delegacions de vot no justificades explícitament en el Reglament del Parlament.

Les votacions per constituir la Mesa del Parlament han ocupat el gros de la sessió:
- en la primera votació per elegir la presidència del Parlament s'exigeix el suport de la majoria absoluta de la cambra. El mateix president de la mesa d'edat, Colomines, havia constatat que aquest Parlament és un parlament de minories, i això s'ha vist en els resultats: Silvia Paneque (PSC, 42 vots, presumiblement tots del seu propi partit), Josep Rull (Junts+, 35 vots, presumiblement tots del seu propi grup), En Blanc (24 vots; els d'ERC i la CUP), Pere Lluís Huguet (PP, 15 vots, presumiblement tots del seu partit), María Elisa García (Vox, 11 vots, presumiblement tots del seu partit), Susana Segovia (Comuns, 6 vots, presumiblement tots del seu partit) i Nuls (2 vots, els d'Aliança Catalana, que hi han escrit 'Estat Català').
- en la segona votació per elegir president els diputats havien de triar entre els dos més votats en la primera, Paneque i Rull. Rull ha rebut 59 vots (els de Junts+, ERC i CUP), Paneque n'ha rebut 42 (els del PSC), hi ha hagut 32 vots en blanc (PP, Vox i Comuns) i 2 vots nuls (els 'Estat Català' d'Aliança Catalana).
- en la tercera votació s'elegien les dues vicepresidències del Parlament. Raquel Sans (ERC) ha rebut 59 vots (els de Junts+, ERC i CUP); David Pérez (PSC) n'ha rebut 42 (els del PSC); Pere Lluís Huguet (PP) n'ha rebut 15 (els del PP); Sergio Macián de Greef (Vox) n'ha rebut 11 (els de Vox); 6 vots en blanc (els de Comuns) i 2 vots nuls (els 'Estat Català' d'Aliança Catalana). Així Sans serà la vicepresidenta primera i Peréz el vicepresident segon.
- en la quarta votació s'elegien les quatre secretaries de la Mesa del Parlament. Glòria Freixa (Junts+) ha rebut 30 vots (la majoria de Junts+); Juli Fernàndez (ERC) ha rebut 29 vots (els d'ERC i de la CUP i els 5 que resten de Junts+); Rosa Maria Ibarra ha rebut 25 vots (del PSC i de Comuns); Judit Alcalá ha rebut 23 vots (del PSC i Comuns); Pere Lluís Huguet ha rebut 15 vots (del PP); Manuel Acosta ha rebut 11 vots (de Vox); i 2 vots nuls (els 'Estat Català' d'Aliança Catalana). Així Freixa serà la secretària primera; Fernàndez serà el secretari segon; Ibarra serà el secretari tercer; i Alcalá serà la secretària quarta. D'aquesta manera a la Mesa seran representats únicament tres principals partits, PSC (1 vicepresidència i 2 secretaries), Junts+ (la presidència i 1 secretaria) i ERC (1 vicepresidència i 1 secretaria).

Correspondrà ara al president Rull iniciar una ronda de converses per proposar al Ple un candidat a la Presidència de la Generalitat. La publicació avui de la Llei Orgànica 1/2024, de 10 de juny, d'amnistia per a la normalització institucional, política i social a Catalunya podria facilitar el retorn a Catalunya dels diputats Puigdemont, Puig i Wagensberg. Que la Mesa del Parlament tingui una majoria independentista pot indicar que Rull proposi com a candidat a la presidència de la Generalitat a Carles Puigdemont. L'altre candidat viable és Salvador Illa. Puigdemont podria comptar amb el suport de 59 diputats (Junts+, ERC i CUP), però tan sols l'abstenció del PSC faria possible la seva elecció com a president. D'altra banda Illa tan sols comptaria d'entrada amb 48 diputats (PSC i Comuns), i caldria l'abstenció de la majoria de diputats independentistes per ser elegit president. Tan sols acords en aquest sentit evitaria que la cambra fos dissolta automàticament a final d'agost.

dilluns, 10 de juny del 2024

La composició del Desè Parlament Europeu

Ahir van concloure les eleccions al Parlament Europeu.

Els resultats provisionals són els següents:
- Grup del Partit Popular Europeu (Democristians) (EPP): 186 escons.
- Grup de l'Aliança Progressista de Socialistes i Demòcrates en el Parlament Europeu (S&D): 134 escons.
- Grup Renovar Europa (Renew Europe): 79 escons.
- Grup de Conservadors i Reformistes Europeus (ECR): 73 escons.
- Grup d'Identitat i Democràcia (ID): 58 escons.
- Hi ha 55 escons dels que no se sap l'adscripció que prendran.
- Grup dels Verds/Aliança Lliure Europea (Greens/EFA): 53 escons.
- Hi ha 46 escons en la categoria de No Inscrits (NI).
- Grup d'Esquerra en el Parlament Europeu - GUE/NGL (The Left): 36 escons.

Els resultats provisionals a Espanya són els següents:
- 18.111.070 persones s'han abstingut (50,78% del cens)
- 5.963.074 persones (34,18% dels vots) han donat suport al Partit Popular (PP). Això es tradueix en 22 diputats per al Grup EPP.
- 5.261.293 persones (30,19% dels vots) han donat suport al Partit Socialista Obrer Espanyol (PSOE). Això es tradueix en 20 diputats per al Grup S&D.
- 1.678.218 persones (9,62% del vots) han donat suport a Vox. Això es tradueix en 6 diputats per al Grup ECR.
- 856.500 persones (4,93% dels vots) han donat suport a Ara Repúbliques (coalició formada per Esquerra Republicana de Catalunya, Euskal Herria Bildu, Bloque Nacionalista Galegi, Ara Més i altres). Això es tradueix en 3 diputat (2 per al Grup Green/EFA i 1 per al Grup The Left).
- 811.545 persones (4,65% dels vots) han donat suport a Sumar (coalició formada pel Moviment Sumar, Catalunya en Comú, Compromís, Esquerra Unida, Más Madrid, Verds Equo, Iniciativa del Pueblo Andaluz, Nueva Canarias - Bloque Canarista). Això es tradueix en 3 diputats (2 per al Grup Green/EFA i 1 d'Altres).
- 800.763 persones (4,58% dels vots) han donat suport a l'Agrupació d'Electors Se Acabó La Fiesta (SALF). Això es tradueix en 3 diputats d'Altres.
- 571.902 persones (3,27% dels vots) han donat suport a Podem. Això es tradueix en 2 diputats per al Grup The Left.
- 443.275 persones (2,55% dels vots) han donat suport a Junts UE (coalició Junts i Lliures per Europa, formada per Junts, Demòcrates de Catalunya, Moviment d'Esquerres de Catalunya i altres). Això es tradueix en 1 diputat No Inscrit.
- 281.064 persones (1,61% dels vots) han donat suport a la Coalició CEUS (formada per l'Euzko Alderdi Jeltzalea - Partido Nacionalista Vasco, Coalición Canaria, El Pi - Proposta per les Illes Balears, Agrupación Atarrabia - Atarrabia Taldea, Geroa Socialverdes de Navarra en Europa - Geroa Nafarroako Sozialberdeak Europan). Això es tradueix en 1 diputat per al Grup Renew Europe.
- 134.425 persones (0,77%) han votat el PACMA.
- 123.620 vots han estat en blanc (el 0,70% dels vots vàlids).
- 123.354 vots han estat anul·lats (el 0,70% dels vots emesos).
- 121.031 persones (0,69% dels vots) han donat suport a Ciudadanos (Cs).
- 66.242 persones (0,38%) han donat suport al Frente Obrero (FO).
- 40.107 persones (0,23%) han donat suport a Existe.
- 32.717 persones (0,18% dels vots) han donat suport a Izquierda Española (IzqEsp).
- 28.778 persones (0,16% dels vots) han donat suport a Feministas al Congreso (PFAC).
- 27.407 persones (0,15% dels vots) han donat suport a Iustitia Europa.
- 24.163 persones (0,13% dels vots) han donat suport a Andalucistas.
- 21.470 persones (0,12% dels vots) han donat suport a Volt.
- 20.586 vots (0,11% dels vots) han donat suport a Escaños en Blanco.
- 15.176 persones (0,08% dels vots) han donat suport al Partit Comunista dels Treballadors d'Espanya (PCTE).
- 14.442 persones (0,08% dels vots) han donat suport a Pirates/Rebels.
- 11.718 perones (0,06% dels vots) han donat suport al Partit Comunista dels Pobles d'Espanya (PCPE/PCPC).
- 9.643 persones (0,05% dels vots) han donat suport a la Falange Española de las JONS (FE de las JONS).
- 9.253 persones (0,05% dels vots) han donat suport a Sobirania Alimentària Espanyola (SAE).
- 9.227 persones (0,05% dels vots) han donat suport a Cree en Europa.
- 7.588 persones (0,04% dels vots) han donat suport a Recortes Cero.
- 7.017 persones (0,04% dels vots) han donat suport a País i Moviment Rural (PMR).
- 6.418 persones (0,03% dels vots) han donat suport al Partit Humanista (PH).
- 6.343 persones (0,03% dels vots) han donat suport al PREPAL de Salamanca-Zamora-León.
- 5.777 persones (0,03% dels vots) han donat suport a Futuro (F).
- 5.616 persones (0,03% dels vots) han donat suport a Juntos por Extremadura (J.U.E.X.).
- 5.604 persones (0,03% dels vots) han donat suport al Partido Galego (GLG).
- 5.527 persones (0,03% dels vots) han donat suport al Corrent Revolucionari dels Treballadors (CRT).
- 3.502 persones (0,02% dels vots) han donat suport a Extremeños.

Els resultats provisionals a la Comunitat Autònoma de Catalunya han estat els següents:
- 3.115.771 persones s'han abstingut (56,46% del cens).
- 732.362 persones (30,63% dels vots) han donat suport al PSC-PSOE.
- 430.925 persones (18,02% dels vots) han donat suport a Junts UE.
- 354.247 persones (14,81% dels vots) han donat suport a ERC-Ara Repúbliques.
- 329.459 persones (13,78% dels vots) han donat suport al PP.
- 147.946 persones (6,18% dels vots) han donat suport a Vox.
- 110.175 persones (4,60% dels vots) han donat suport a Podem.
- 102.831 persones (4,30% dels vots) han donat suport a Comuns Sumar.
- 67.296 persones (2,81% dels vots) han donat suport a la Agrupació d'Electors "Se Acabó La Fiesta".
- 31.264 persones (1,30% dels vots) han donat suport al PACMA.
- 15.196 vots (0,63% dels vots vàlids) han estat en blanc.
- 13.310 persones (0,55% dels vots) han donat suport a Cs.
- 11.547 vots (0,48% dels emesos) han estat anul·lats.
- 8.761 perones (0,36% dels vots) han donat suport al Frente Obrero.
- 6.217 persones (0,26% dels vots) han donat suport a Pirates.Cat/Rebels.
- 5.728 persones (0,23% dels vots) han donat suport a Feministas al Congreso.
- 5.089 persones (0,21% dels vots) han donat suport a Iustitia Europa.
- 3.033 persones (0,12% dels vots) han donat suport a Escaños en Blanco.
- 2.801 persones (0,11% dels vots) han donat suport a Izquierda Española.
- 2.765 persones (0,11% dels vots) han donat suport a Volt.
- 2.626 persones (0,10% dels vots) han donat suport al PCTC.
- 2.377 persones (0,09% dels vots) han donat suport al PCPE/PCPC.
- 2.208 persones (0,09% dels vots) han donat suport a País i Moviment Rural.
- 2.183 persones (0,09% dels vots) han donat suport a Coalició per una Europea Solidària (CEUS).
- 1.770 persones (0,07% dels vots) han donat suport a Existe.
- 1.282 persones (0,05% dels vots) han donat suport a Andalucistas.
- 1.217 persones (0,05% dels vots) han donat suport a Recortes Cero.
- 1.206 persones (0,05% dels vots) han donat suport al Corrent Revolucionari dels Treballadors.
- 961 persones (0,04% dels vots) han donat suport a J.U.E.X.
- 890 persones (0,03% dels vots) han donat suport a FE de las JONS.
- 806 persones (0,03% dels vots) han donat suport al Partido Galego.
- 776 persones (0,03% dels vots) han donat suport a Cree en Europea.
- 731 persones (0,03% dels vots) han donat suport al Partit Humanista.
- 700 persones (0,02% dels vots) han donat suport a Sobirania Alimentària Espanyola.
- 553 persones (0,02% dels vots) han donat suport a PREPAL.
- 485 persones (0,02% dels vots) han donat suport a Futuro.
- 278 persones (0,01% dels vots) han donat suport a Extremeños.

Els resultats provisionals a la província de Barcelona són:
- 2.257.805 persones (55,24% del cens) s'han abstingut.
- 585.958 persones (32,15% dels vots) han donat suport al PSC.
- 288.116 persones (15,81% dels vots) han donat suport a Junts UE.
- 259.634 persones (14,24% dels vots) han donat suport al PP.
- 256.874 persones (14,09% dels vots) han donat suport a ERC-Ara Repúbliques.
- 109.879 persones (6,03% dels vots) han donat suport a Vox.
- 93.674 persones (5,14% dels vots) han donat suport a Podem.
- 87.235 persones (4,78% dels vots) han donat suport a Comuns Sumar.
- 51.924 persones (2,84% dels vots) han donat suport a 'Se Acabó La Fiesta'.
- 24.746 persones (1,35% dels vots) han donat suport al PACMA.
- 11.013 persones (0,60% dels vots) han donat suport a Cs.
- 10.758 persones han votat en blanc (0,59% dels vots vàlids).
- 7.326 persones han vist el seu vot anul·lat (0,40% dels vots emesos).
- 7.004 persones (0,38% dels vots) han votat al Frente Obrero.
- 4.635 persones (0,25% dels vots) han donat suport a Feministas al Congreso.
- 4.571 persones (0,25% dels vots) han donat suport a Pirates.Cat/Rebels.
- 3.769 persones (0,20% dels vots) han donat suport a Iustitia Europa.
- 2.330 persones (0,12% dels vots) han donat suport a Izquierda Española.
- 2.291 persones (0,12% dels vots) han donat suport a Escaños en Blanco.
- 2.122 persones (0,11% dels vots) han donat suport a Volt.
- 1.901 persones (0,10% dels vots) han donat suport a PCTC.
- 1.784 persones (0,09% dels vots) han donat suport a PCPE/PCPC.
- 1.660 persones (0,09% dels vots) han donat suport a CEUS.
- 1.463 persones (0,08% dels vots) han donat suport a País i Moviment Rural.
- 1.423 persones (0,07% dels vots) han donat suport a Existe.
- 1.006 persones (0,05% dels vots) han donat suport al CRT.
- 980 persones (0,05% dels vots) han donat suport a Recortes Cero.
- 949 persones (0,05% dels vots) han donat suport a Andalucistas.
- 653 persones (0,03% dels vots) han donat suport a FE de las JONS.
- 617 persones (0,03% dels vots) han donat suport al Partido Galego.
- 601 persones (0,03% dels vots) han donat suport a Cree en Europa.
- 593 persones (0,03% dels vots) han donat suport a J.U.E.X.
- 562 persones (0,03% dels vots) han donat suport al Partit Humanista.
- 431 persones (0,02% dels vots) han donat suport a PREPAL.
- 399 persones (0,02% dels vots) han donat suport a SAE.
- 352 persones (0,01% dels vots) han donat suport a Futuro.
- 216 persones (0,01% dels vots) han donat suport a Extremeños.

Els resultats provisionals a Esplugues de Llobregat són:
- 17.766 persones (51,94% del cens) s'han abstingut.
- 6.346 persones (38,71% dels vots) han donat suport al PSC.
- 3.324 persones (20,27% dels vots) han donat suport al PP.
- 1.584 persones (9,66% dels vots) han donat suport a ERC-Ara Repúbliques.
- 1.453 persones (8,86% dels vots) han donat suport a Junts UE.
- 1.077 persones (6,57% dels vots) han donat suport a Vox.
- 750 persones (4,57% dels vots) han donat suport a Podem.
- 603 persones (3,67% dels vots) han donat suport a Comuns Sumar.
- 520 persones (3,17% dels vots) han donat suport a 'Se Acabó La Fiesta'.
- 176 persones (1,07% dels vots) han votat el PACMA.
- 126 persones (0,76% dels vots) han donat suport a Cs.
- 84 persones han votat en blanc (0,51% dels vots vàlids).
- 66 persones (0,40% dels vots) han donat suport al Frente Obrero.
- 42 persones han vist anul·lat el seu vot (0,25% dels vots emesos).
- 37 persones (0,22% dels vots) han donat suport a Feministas al Congreso.
- 35 persones (0,21% dels vots) han donat suport a Iustitia Europa.
- 24 persones (0,14% dels vots) han donat suport a Izquierda Española.
- 23 persones (0,14% dels vots) han donat suport a Pirates.Cat/Rebels.
- 21 persones (0,12% dels vots) han donat suport a Escaños en Blanco.
- 19 persones (0,11% dels vots) han donat suport a Volt.
- 16 persones (0,09% dels vots) han donat suport al PCTC.
- 16 persones (0,09% dels vots) han donat suport a Existe.
- 13 persones (0,07% dels vots) han donat suport a CEUS.
- 13 persones (0,07% dels vots) han donat suport al PCPE/PCPC.
- 11 persones (0,06% dels vots) han donat suport a Recortes Cero.
- 11 persones (0,06% dels vots) han donat suport a País i Moviment Rural.
- 9 persones (0,05% dels vots) han donat suport a Andalucistas.
- 7 persones (0,04% dels vots) han donat suport a Cree en Europa.
- 6 persones (0,03% dels vots) han donat suport a SAE.
- 5 persones (0,03% dels vots) han donat suport a FE de las JONS.
- 4 persones (0,02% dels vots) han donat suport al CRT.
- 4 persones (0,02% dels vots) han donat suport al Partido Galego.
- 3 persones (0,01% dels vots) han donat suport a Futuro.
- 3 persones (0,01% dels vots) han donat suport a J.U.E.X.
- 1 persona (0,01% dels vots) ha donat suport al Partit Humanista.
- 1 persona (0,01% dels vots) han donat suport a PREPAL.

A Can Vidalet eren convocats 9.676 electors:
- 4355 han emès el seu vot.
- 2135 electors (49,14% dels vots) han votat el PSC-PSOE.
- 942 persones (21,68% dels vots) han votat el PP.
- 371 persones (8,54% dels vots) han votat Vox.
- 188 persones (4,33% dels vots) han votat ERC-Ara Repúbliques.
- 167 persones (3,84% dels vots) han votat Podemos.
- 143 persones (3,29% dels vots) han votat Sumar-Comuns Sumar.
- 130 persones (2,99% dels vots) han votat 'Se Acabó La Fiesta'.
- 97 persones (2,23% dels vots) han votat Junts-UE.
- 45 persones (1,04% dels vots) han votat el PACMA.
- 32 persones (0,74% dels vots) han votat Cs.
- 22 persones (0,51% dels vots) han votat en blanc.
- 15 persones (0,35% dels vots) han votat Frente Obrero.
- 10 electors han vist anul·lat el seu vot.
- 10 persones (0,23% dels vots) han votat Escaños en Blanco.
- 8 persones (0,18% dels vots) han votat PCTC.
- 7 persones (0,16%) han votat Iustitia Europa.
- 5 persones (0,12% dels vots) han votat Andalucistas.
- 4 persones (0,09% dels vots) han votat Existe.
- 3 persones (0,07% dels vots) ha votat Izquierda Española.
- 3 persones (0,07% dels vots) han votat Volt.
- 3 persones (0,07% dels vots) han votat SAE.
- 2 persones (0,05% dels vots) han votat PFAC.
- 2 persones (0,05% dels vots) han votat Pirates.Cat/Rebels.
- 2 persones han votat J.U.E.X.
- 2 persones han votat Cree en Europa.
- 2 persones han votat CRT.
- 1 persona ha votat Futuro.
- 1 persona ha votat FE de las JONS.
- 1 persona ha votat País i Moviment Rural.
- 1 persona ha votat PCPE/PCPC.
- 1 persona ha votat Recortes Cero.

A la secció 002 de Can Vidalet hi havia 1108 electors censats, dels quals 566 van votar:
- 274 vots al PSC-PSOE.
- 133 vots al PP.
- 33 vots a Vox.
- 31 vots a Podem.
- 26 vots a 'Se Acabó La Fiesta'.
- 23 vots a Sumar.
- 13 vots a ERC-Ara Repúbliques.
- 12 vots a Junts-UE.
- 6 vots a Cs.
- 4 vots a PACMA.
- 2 vots nuls.
- 2 vots a Frente Obrero.
- 2 vots a Pirates.Cat/Rebels.
- 1 vot a J.U.E.X.
- 1 vot a PFAC.
- 1 vot a PCPE/PCPC.
- 1 vot a Escaños en Blanco.
- 1 vot en blanc.

A la mesa B d'aquesta secció votaven 630 electors, dels quals van votar 326:
- 162 vots al PSC-PSOE.
- 68 vots al PP.
- 24 vots a Vox.
- 20 vots a Podemos.
- 13 vots a Se Acabó La Fiesta.
- 10 vots a Junts UE.
- 9 vots a ERC-Ara Repúbliques.
- 9 vots a Sumar.
- 4 vots a Cs.
- 2 vots nuls.
- 2 vots a Pirates.Cat/Rebels.
- 1 vot al PCPE/PCPC.
- 1 vot al PFAC.
- 1 vot a J.U.E.X.