dilluns, 9 d’agost de 2021

La base física del Sisè Report de Valoració Panell Intergovernamental sobre Canvi Climàtic

El Panell Intergovernamental sobre Canvi Climàtic (IPCC) es troba en el procés d’elaboració del Sisè Report de Valoració (AR6), del qual avui s’ha presentat l’aportació del Primer Grup de Treball, corresponent a la base de ciència física. Aquesta contribució vol presentar quina és la comprensió física actual del sistema climàtic i del canvi climàtic, combinant els avenços realitzats en climatologia amb les evidències paleoclimàtiques, les observacions actuals i les simulacions climàtiques globals i regionals. Aquesta aportació ha estat aprovada en la 14ª Sessió del Primer Grup de Treball i la 54ª Sessió de l’IPCC que s’han celebrat aquests dies a Ginebra.

L’estat actual del clima

El report considera inequívoc que la influència humana ha escalfat l’atmosfera, l’oceà i la terra, alhora que canvis amplis i ràpids han tingut lloc en l’atmosfera, l’oceà, la criosfera i la biosfera. L’augment observat en les concentracions de gasos d’efecte hivernacle des de mitjan segle XVIII és causat inequívocament per activitats humanes. En el decurs de la darrera dècada s’han arribat a mitjanes anuals de 410 ppm per al diòxid de carboni (CO2), de 1,866 ppm per al metà (CH4) i de 0,332 ppm per l’òxid nitrós (N2O). Terra i oceà han absorbit vora un 56% de les emissions antropogèniques anuals de CO2 en el decurs de les darreres sis dècades.

L’escalfament es manifesta en el fet que les dues primeres dècades del segle XX han estat, en termes de temperatura superficial global, 0,99 K per damunt del nivell de la segona meitat del segle XIX. Les temperatures continentals han augmentat més que les oceàniques. Aquest escalfament és mediat per les emissions antropogèniques de gasos d’efecte hivernacle, davant del qual l’efecte de refredament dels aerosols antropogènics és menystenible, i encara més ho són les causes naturals de variabilitat climàtica.

El report també constata que és probable que la precipitació sobre els continents ha augmentat des del 1950, i de manera accelerada des els anys 1980. Els cursos de les tempestes de latituds mitjanes s’han desplaçat en direcció cap als pols.

El report considera que és molt probable que la influència humana sigui el principal motor de la retirada global de glaceres des dels anys 1990.

Les emissions antropogèniques de CO2 són el principal motor de l’actual acidificació global de les capes superficials de l’oceà obert.

L’escala dels canvis recents en el sistema climàtic en general no tenen precedents en els darrers segles o mil·lennis. Així doncs, els nivells atmosfèrics de CO2 són els més alts dels darrers 2 milions d’anys. L’augment de la temperatura superficial global en els darrers 50 anys ha estat el més ràpid dels darrers dos mil·lennis. L’augment del nivell global del mar és el més elevat dels darrers 3000 anys.

El canvi climàtic antropogènic ja afecta totes les regions del planeta en termes d’extrems meteorològics: ones de calor, fortes precipitacions, sequeres, ciclons tropicals, etc. En general, els extrems càlids s’han fet més freqüents des del 1950, mentre que els extrems freds han vist reduïda la freqüència i la severitat.

Possibles climes de futur

El report contempla cinc escenaris d’emissions d’efecte hivernacle, i els seus resultats a curt termini (2021-2040), mig termini (2041-2060) i llarg termini (2081-2100).

En tots els escenaris contemplats, l’augment de la temperatura superficial global es manté fins a mitjan segle XXI. Si no hi ha una reducció profunda en les emissions de gasos d’efecte hivernacle, l’escalfament global en el curs del segle XXI depassaria el valor de 1,5 K i fins i tot el del 2 K. En l’escenari pitjor, SSP5-8,5, l’escalfament global a final del segle XXI seria de 4,4 K respecte dels valors preindustrials.

El canvi climàtic s’associa amb una intensificació del cicle global de l’aigua, que guanyaria en variabilitat i es manifestaria en una major freqüències d’esdeveniments meteorològics extrems.

Fins i tot si l’escalfament antropogènic es limités a 1,5 K, el nivell global de la mar pujaria de 2-3 metres durant els propers 2000 anys.

L’adaptació al canvi climàtic

En fer planificacions regionals cal entendre l’efecte modulador de factors naturals i de la variabilitat interna sobre els canvis climàtics antropogènics. De tota manera, el report contempla una intensificació de precipitacions extremes i de sequeres. Afebliments de circulacions oceàniques podrien amplificar l’impacte del canvi climàtic global a escala regional.

La mitigació del canvi climàtic

La mitigació de l’escalfament global exigiria arribar a una situació d’emissió neta zero de CO2 i de forta reducció de les emissions altres gasos d’efecte hivernacle.

El report també contempla mesures de retirada antropogènica de CO2 atmosfèric, per bé que recorda que aquesta tecnologia pot tindre també efectes sobre els cicles biogeoquímics i el clima, i afectar la disponibilitat i qualitat de l’aigua, la producció d’aliments i la biodiversitat.

Lligams:

- IPCC AR6 WGI Full Report.

- IPCC WGI Interactive Atlas.

dissabte, 7 d’agost de 2021

miSHERLOCK: una tecnologia CRISPR per al diagnòstic de variants de SARS-CoV-2

Genètica molecular: Lluís Montoliu, del Centro Nacional de Biotecnología (CNB-CSIC) y del CIBERER-ISCIII, de Madrid, es demana en el darrer número de la Revista del Col·legi de Biòlegs de Catalunya què podem esperar de les eines CRISPR durant aquesta pandèmia COVID-19. Ens recorda que ja en el març del 2020, Feng Zhang proposà l’aplicació del seu sistema SHERLOCK, basat en el sistema CRISPR Cas13a en la detecció de còpies genòmiques de SARS-CoV-2 en mostres clíniques. El cas és que durant tots aquests mesos el diagnòstic d’infecció per SARS-CoV-2 (covid-19) s’ha fet fonamentalment a través de tecnologies d’amplificació (RT-PCR i TMA) i de tests d’antígens. Això entranya una dificultat en el seguiment de les variants de SARS-CoV-2, que es fa amb l’ús de tècniques de seqüenciació genètica, aplicades únicament a una petita mostra dels casos positius de covid-19. James J. Collins, del Wyss Institute for Biologically Inspired Engineering de la Harvard Institute, és l’autor corresponsal d’un article a Science Advances, encapçalat per Helena de Puig, Rose A. Lee i Devora Najjara, en el que es presenta una tècnica SHERLOCK d’instrumentació mínima (miSHERLOCK) per al diagnòstic d’infecció de SARS-CoV-2 i de les variants emergents d’aquest virus. Disposar d’una tècnica així possibilitaria identificar en la saliva de cada pacient de covid-19 quina o quines variants de SARS-CoV-2 l’infecten. La saliva és introduïda a la plataforma de diagnòstic sense processar: hi segueix una extracció, purificació i concentració d’ARN viral, amb reaccions d’amplificació i detecció, que són detectades per fluorescència. L’usuari tan sols hi ha de de fer tres accions, i en una hora obté resposta. La plataforma és capaç d’oferir resultats sobre la presència de SARS-CoV-2 i sobre mutacions associades amb les variants 20I (Alfa, V1), 20H (Beta, V2) i 20J (Gamma, V3). La modularitat del sistema permet un fàcil bescanvi d’assaigs per adaptar-se a les necessitats de l’usuari. També compta amb una aplicació de mòbils per a quantificació de resultats, interpretació automatitzada i distribució remota de les dades.

El dispositiu miSHERLOCK

CRISPR i SHERLOCK

Helena de Puig, Rose A. Lee, Devora Najjar i Xiao Tan dissenyaren i realitzaren experiments, analitzaren les dades i redactaren l’article. Luis R. Soekensen, Nicolaas M. Angenent-Mari, Nina M. Donghia, Nicole E. Weckman, Carlos F. Ng, Peter Q. Nguyen, Audrey Ory, Angelo S. Mao, Thomas C. Ferrante, Geoffrey Lansberry, Hani Sallum i James Niemi realitzaren experiments i editaren l’article. James J. Collins dirigí la recerca i edità l’article, del qual és l’autor corresponsal. Cal recordar que Collins és cofundador i director de Sherlock Biosciences, mentre que Weckman és cofundadora i consultora de 52 North Health Ltd. Els autors agraeixen a M. A. English discussions i assessorament. La recerca es finança a través del Paul G. Allen Frontiers Group, el Wyss Institute for Biologically Inspired Engineering, i dels projectes de Puig, Lee, Tao i Angenent-Mari.

El sistema CRISPR/Cas constitueix un element de la immunitat adaptativa de bacteris i, en aquest sentit, es caracteritza per l’especificitat de resposta a seqüències genètiques. Aquesta especificitat fa que hom l’utilitzi en aplicacions d’edició genètica, però encara més dreturer és utilitzar-lo en diagnòstic molecular.

L’acrònim CRISPR fa referència a repeticions palindròmiques breus regularment espaiades en clústers. L’acrònim SHERLOCK es construeix a partir de “specific high-sensitivity enzymatic reporter unlocking”, i aprofita Cas13a (o Cas12a) per detectar seqüències nucleotídiques específiques.

En el decurs de tots aquests mesos, s’han desenvolupat tests basats en SHERLOCK o en DETECTR per al diagnòstic de la infecció de SARS-CoV-2, però el cert és que no poden oferir gaire més d’allò que ofereixen els altres tests (RT-PCR, TMA, tests d’antígens). El repte de diagnòstic rau en la identificació de variants de SARS-CoV-2, i de mutacions com S:N501Y, S:E484K, que ara es fa en centres especialitzats de seqüenciació: hom té doncs dades epidemiològiques de les variants i de les mutacions de SARS-CoV-2, però en la immensa majoria de pacients de covid-19 no hi ha més que la dada del diagnòstic general.

Puig et al. presenten un miSHERLOCK, és a dir una variant de SHERLOCK d’instrumentació mínima, capaç de la detecció universal de SARS-CoV-2 i de les variants Alpha, Beta i Gamma en mostres de saliva en un sistema autocontingut i de baix cost que fa possible utilitzar-lo en centres d’assistència primària. La plataforma utilitza un mètode de captura d’ARN en paper, amb ulterior amplificació in situ i detecció per Cas. El límit de detecció són 1000 còpies genòmiques/mL. Com a mostra clínica utilitza la saliva, i això fa que el sistema hagi d’incorporar una etapa de filtració i concentració. Encara que el sistema únicament considera les mutacions N501Y i E484K, s’hi poden integrar d’altres com la Y144del.

El disseny del sistema

Per garantir la detecció universal de SARS-CoV-2, s’utilitzaren 43.305 seqüències completes obtingudes de NCBI i alineades amb MAFFT. Per a la variant Alfa, s’empraren 50.001 seqüències genòmiques; per a la variant Beta, 577; per a la variant Gamma, 78.

La seqüència de Cas12 gRNA consta d’una regió de mànec (UAAUUUCUACUAAGUGUAGAU), que permet el reconeixement i unió de la proteïna Cas, i d’una regió adjacent a 3’ que defineix l’usuari segons quina ha d’ésser la diana diagnòstica.

Per a l’amplificació RPA es dissenyaren de 10 a 21 encebadors en els dos sentits per cada diana, amb una longitud d’entre 25 i 40 nucleòtids, i que haurien de donar lloc a amplicons de 100 a 200 parells de nucleòtids.

Com a subjectes experimentals s’utilitzaren mostres clíniques desidentificades procedents de la República Dominicana, i obtingudes a través de Boca Biolistics.

També s’utilitzaren mostres clíniques simulades, elaborades a partir de ATCC VR-1986HK, un preparat inactivat per calor de SARS-CoV-2, que eren abocades a aigua o a saliva humana (adquirida a BioIVT).

Utilitzaren els coronavirus endèmics OC43 i 229E, adquirits d’ATCC, en els experiments d’especificitat.

De Twist Bioscience s’adquiriren variants de SARS-CoV-2 Alfa, Beta i Gamma. També es generaren mutacions sintètiques.

Una vegada seleccionats els reactius, s’utilitzà el programari CAD per dissenyar la plataforma. Els components del sistema foren fabricats amb una impressora 3D en resina negra.

L’aplicació mòbil associada a la plataforma fou construïda amb Xcode, C++, Objective-c, OpenCV 3.1 i Swift.

Construïda la plataforma, es validà amb mostres de pacients.

La diana seleccionada: una regió del gen N

La regió 3’ del genoma dels coronavirus és la més interessant per a les tècniques de detecció, ja que apareix en còpies subgenòmiques produïdes en el decurs de la infecció. En aquesta regió trobem el gen N, que codifica per a la nucleocàpside, proteïna del virió que entra en contacte amb el genoma viral. Puig et al. seleccionaren una regió del gen N altament conservada i característiques de SARS-CoV-2.

El sistema SHERLOCK consta de dos components, un dedicat a l’amplificació isotèrmica de la seqüència diana, i l’altre dedicat a la detecció mediada per Cas de l’amplicó. Aquesta amplificació isotèrmica s’aconsegueix amb un sistema de recombinasa i polimerasa (RPA). És definida pel parell d’encebadors emprats i pels ARN guia (gRNAs). Dels 30 gRNA assajats per Puig et al., el millor és idèntic al 90,7% de les 43.000 seqüències genòmiques contemplades de SARS-CoV-2: l’excepció es deu en un 7,4% dels casos a un polimorfisme C>T de la regió 3’, que no seria problema per a la detecció de Cas12a. Dels 100 parells d’encebadors assajats per Puig et al., el millor és idèntic al 97% dels genomes contemplats.

Puig et al. aconsegueixen percentatges més alts i tot per als gRNA i encebadors dissenyats per a la detecció específica de les variants Alfa, Beta i Gamma.

En les proves realitzades el límit de detecció de l’ARN de SARS-CoV-2 dissolt en aigua per part del miSHERLOCK és de 20.000 còpies/mL, amb un temps de reacció de 55 minuts. No hi ha indicis de reactivitat creuada amb els betacoronavirus endèmics OC43 i 229E.

La mutació S:N501Y, que resulta del polimorfisme A23063U és compartida per les variants Alfa, Beta i Gamma. El gRNA i els encebadors seleccionats per Puig et al. són altament específics per a aquesta mutació, per bé que escapen algunes subvariants amb un polimorfisme G>A en la posició +7 de l’encebador.

La mutació S:Y144del, que resulta d’una deleció de 3 nucleòtids, és característica de la variant Alfa, i permet diferenciar-la de les variants Beta i Gamma. El gRNA i encebadors seleccionats per Puig et al. permeten a miSHERLOCK de discriminar clarament la variant Alfa de la variant originària.

La mutació S:E484K, deguda al polimorfisme G23012A, és present a les variants Alfa, Beta i Gamma, i és potser la més rellevant en termes clínics. El gRNA i encebadors seleccionats per Puig et al. permeten discriminar-la.

La simplificació de passes.

El sistema miSHERLOCK s’adreça a usuaris no-especialistes, que l’operaran sobre mostres de pacients en l’atenció primària, en una oficina de farmàcia o inclús en un entorn no-sanitari. Puig et al. han fet un esforç d’enginyeria per simplificar-ne l’operació. Per això han optimitzat tampons, retrotranscriptases i sistemes de fluorescència. Per exemple, l’addició de la ribonucleasa H (enzim que degrada ARN) millora la cinètica de reacció i augmenta la producció de fluorescència del sistema de detecció.

Puig et al. han adaptat el seu sistema a l’anàlisi de saliva, i no pas a hisops nasofaringis o nasals. La saliva, al capdavall, és més fàcil de collir. Ara bé, aquesta saliva ha d’ésser tractada prèviament, ja que les nucleases salivals podrien generar falsos positius en atacar els reportadors fluorescents. Alhora, el tractament ha de disminuir la viscositat de la saliva, i augmentar l’accessibilitat del material genòmic d’aquesta matriu. El tractament de la saliva que fa el miSHERLOCK inactiva les nucleases (amb ditiotreitol i EGTA), lisa les partícules virals presents (a una temperatura de 95°C), i concentra els àcids nucleics resultants en una membrana porosa (de polietersulfona).

El resultat final del tractament de la saliva és la captura d’àcids nucleics. Llavors comença la reacció pròpiament dita, a una temperatura de reacció de 37°C. Si és present l’àcid nucleic diana, hi ha una generació de fluorescència.

El conjunt del dispositiu diagnòstic té un cost de 15 dòlars USA, i cada assaig costaria 6 $, un preu que es deu sobretot als components enzimàtics de les reaccions d’amplificació i detecció.

L’aparell en funcionament

L’usuari introdueix 2 mL de saliva en el col·lector. Seguidament, activa l’escalfador de l’aparell. En 3-6 minuts, es produeix la deposició de l’ARN salival en la membrana. Llavors l’usuari ha de retirar el col·lector i transferir la columna de preparació de mostra a la cambra de reacció. Llavors s’inicia una reacció de 55 minuts, al cap dels quals l’usuari podrà constatar el positiu a través de la visualització de fluorescència sota el transil·luminador.

Una aplicació mòbil ajuda a la quantificació automatitzada i a la interpretació de resultats. Els valors positius i negatius poden ésser enviats a una base de dades en-línia.

El límit de detecció de miSHERLOCK per a la detecció universal de gen N de SARS-CoV-2 és de 1240 còpies genòmiques/mL. Per posar-ho en context, direm que xifres semblants hem assolit en les aigües residuals de l’àrea metropolitana de Barcelona en els pics de la pandèmia. Els límits de detecció són semblants per a la detecció de les mutacions Y144del i E484K, però són superiors en el cas de la detecció de la mutació N501Y (49000 còpies/mL).

Amb l’ús de 27 mostres de pacients de covid-19 i de 21 mostres control, Puig et al. han obtingut per al seu dispositius una sensibilitat del 96% i una especificitat del 95%.

Perspectives d’aplicació en l’actual context

A hores d’ara tothom és conscient de la importància de disposar de dades precises sobre les variants de SARS-CoV-2 presents en cada context geogràfic i social. El dispositiu de Puig et al. té una gran potencialitat per dissenyar múltiplex de mutacions de SARS-CoV-2 que ens donin informació de la variant concreta que infecta cada pacient. El cost de la prova se situaria al voltant dels 11 $ en el cas d’assaig dúplex.

Quin avantatge ofereix conèixer la variant de SARS-CoV-2 que afecta un pacient? De moment, poca, ja que els protocols que se seguirien d’aïllament i de tractament no difereixen d’acord amb les variants. Però és possible que el desenvolupament i aplicació de tractaments serològics sí requereixi d’un coneixement de la variant que infecta cada pacient. En un escenari d’emergència de variants que escapessin als vaccins, disposar de tècniques que permetin augmentar el nombre de mostres utilitzats al seguiment genòmic del SARS-CoV-2 serà essencial. I aquest escenari potser ens espera d’un moment a l’altre.

Lligams:

- Minimally instrumented SHERLOCK (miSHERLOCK) for CRISPR-based point-of-care diagnosis of SARS-CoV-2 and emerging variants. Helena de Puig, Rose A. Lee, Devora Najjar, Xiao Tan, Luis R. Soekensen, Nicolaas M. Angenent-Mari, Nina M. Donghia, Nicole E. Weckman, Audrey Ory, Carlos F. Ng, Peter Q. Nguyen, Angelo S. Mao, Thomas C. Ferrante, Geoffrey Lansberry, Hani Sallum, James Niemi and James J. Collins. Science Advances 7: eabh2944 (2021).

divendres, 6 d’agost de 2021

SEROCOV: Cinètica d’anticossos d’una cohort de sanitaris amb covid-19

Durant un any (del 19 de març del 2020 a la mateixa data del 2021), el projecte Serocov-1, coordinat per Alberto García-Basteiro i Carlota Dobaño, de l’Institut de Salut Global de Barcelona, estudià la seroprevalença dels treballadors d’hospitals front el SARS-CoV-2, el coronavirus causant de la pandèmia de covid-19. Amb Gemma Moncunill i Carlota Dobaño com a autores corresponsals, i Natalia Ortega com a primera autora, apareix a la revista Nature Communications un article que relata la cinètica dels anticossos anti-SARS-CoV-2 durant els primers set mesos ulteriors a la infecció i que valora el paper que hi juguen els anticossos preexistents contra els coronavirus endèmics (HCoV-229E, -NL63, -OC43, i -HKU1). En el marc del projecte SeroCov, s’avaluaven amb Luminex els nivells d’anticossos (IgM, IgA, IgG) contra sis antígens de SARS-CoV-2 i contra l’antigen de nucleocàpside dels coronavirus endèmics 229E, NL63, OC43 i HKU1. La capacitat de neutralització per anticossos era valorada per citometria de flux. La cohort d’estudi era formada per 578 treballadors sanitaris de l’àmbit hospitalari, i el període de seguiment abastava fins a 7 mesos. A temps 0, la seroprevalença era del 13,5%, i en el mes 1 ja arribava al 15,6%, per tocar els 16,4% a 6 mesos. Els nivells d’anticossos i la capacitat neutralitzant es demostrava estable al llarg del temps, per bé que la IgG anti-N i la IgM en general tendeixen a esvair-se. Després d’arribar al pic de resposta, els anticossos anti-S experimenten un augment a 150 dies de l’aparició dels primers símptomes en tots els individus, i en el 73% pel que fa a la IgG, i això malgrat que no hi hagi cap re-exposició al virus. Entre els individus seropositius, els valors d’IgG i d’IgA als coronavirus endèmics són més elevats entre els qui passaren la covid-19 sense símptomes que els qui la passaren amb símptomes, cosa indicativa del valor que té l’exposició prèvia als coronavirus endèmics en la paucisimptomaticitat de la covid-19.

Cinètica de la capacitat neutralitzant d’anticossos anti-SARS-CoV-2

L’estudi SeroCov

Ana Angulo, Alberto L. García-Basteiro, Pablo Engel, Gemma Moncunill i Carlota Dobaño dissenyaren aquest estudis. Angeline Cruz, Montserrat Lamoglia, Natalia Ortega, Marta Ribes, Neus Rosell, Ruth Aguilar, Diana Barrios, Dobaño i Sarah Williams recrutaren participants, recolliren dades i obtingueren mostres clíniques. Alfons Jimenez, Marta Vidal, Aguilar, Rocío Rubio, Barrios, Robert A. Mitchell, Laura Puyol, Selena Alonso i Chenjerai Jairoce processaren les mostres, desenvoluparen i realitzaren els assaigs serològiques i les anàlisis. Angulo, Engel i Pablo Hernández-Luis realitzaren l’assaig de neutralització per citometria de flux. Edwards Pradenas, Benjamin Trinité i Julià Blanco realitzaren l’assaig de neutralització basat en pseudovirus. Aguilar, Rebeca Santano, Sonia Barroso, Anna Vilella, Anna Llupià, Antoni Trilla, Pilar Varela i Marta Tortajada contribuïren al disseny i a la interpretació crítica dels resultats. Jordi Chi, Luis Izquierdo, Natalia Rodrigo Melero, Carlo Carolis, Pau Serra, Daniel Parras i Pere Santamaria produïren els anticossos. Ortega i Ribes analitzaren les dades, amb el suport de Santano. Susana Méndez gestionà les dades clíniques. Moncunill i Dobaño supervisaren els assaigs d’anticossos i les anàlisis de dades. El primer redactat de l’article fou realitzat per Ortega, Ribes, Moncunill i Dobaño, i tots els autors aprovaren la versió final, tramesa a Nature Communications el 3 de març del 2021. L’article fou acceptat per a publicació el 16 de juliol, i publicat el 6 d’agost.

L’estudi caracteritza la cinètica d’anticossos i de la corresponent capacitat de neutralització entre març i octubre del 2020 en quatre exploracions transversals sobre la mateixa cohort de treballadors sanitaris d’hospitals. Hom valorar tres isotips (IgM, IgG i IgA) contra sis antígens del betacoronavirus SARS-CoV-2. Alhora hom valora els anticossos contra l’antigen N dels quatre coronavirus endèmics coneguts en humans: els alfacoronavirus 229E i NL63, i els betacoronavirus OC43 i HKU1. Val a dir que aquests quatre coronavirus endèmics eren responsables de vora un 10% de les infeccions agudes respiratòries abans de l’esclat de la pandèmia de covid-19.

Una cohort de 578 treballadors hospitalaris

Els 578 treballadors sanitaris de l’Hospital Clínic de Barcelona que fan part de la cohort de SeroCov foren seleccionats aleatòriament. En el marc del SeroCov se n’ha fet un seguiment en quatre visites:
- la primera (M0) entre el 28 de març i el 9 d’abril del 2020, amb 578 participants.
- la segona (M1) entre el 27 d’abril i el 6 de maig del 2020, amb 566 participants.
- la tercera (M3) entre el 28 de juliol i el 6 d’agost del 2020, amb 70 participants, ja que es convidà exclusivament als participants previs que havien mostrat indicis d’infecció per SARS-CoV-2.
- la quarta (M6) entre el 29 de setembre i el 20 d’octubre del 2020, amb 507 participants.

D’aquesta manera, resulta que en un dels participants el període de seguiment fou de 231 dies (7,7 mesos).

En els primeres visites (M0 i M1) es recollien hisops nasofaringis per fer-hi una rRT-PCR específica de SARS-CoV-2 i mostres de sang per a estudis serològics. Era en la primera visita que es recollia el consentiment informat, d’acord amb el protocol aprovat pel Comitè Ètic de l’Hospital Clínic.

A través de Luminex es valoraven els anticossos IgM, IgG i IgA adreçats a tota la proteïna S de SARS-CoV-2, a les seves subregions S1 i S2, i al domini d’unió a receptor (RBD) que es troba a la regió S1; a tota la proteïna N de SARS-CoV-2 i a la seva regió C-terminal; a tota la proteïna N dels HCoVs HKU1, 229E, OC43 i NL63.

Els anticossos neutralitzants eren estimats d’acord amb el percentatge d’inhibició de la unió de RBD al receptor (ACE2) pel plasma dels participants, valorat en un assaig in vitro de citometria de flux, en una línia cel·lular estable murina que expressa el receptor ACE2, que és exposada a la proteïna de fusió RBD-mFc.

507 individus participaren en la quarta visita

De la cohort inicial, un 12,3% no acudiren a la quarta visita, sis mesos després del recrutament. Sí acudiren 507 individus, amb una edat de 42,7±11,2 anys, dels quals el 72% eren dones. Les mostres obtingudes en les visites anteriors (M01, M1 i M3) i en aquesta visita (M6) foren assajades de nou: si la seroprevalença a M0 era del 13,5%, es passava al 15,6% en la M1 i al 16,4% en la M6.

És interessant remarcar que entre les visites M1 i M3 s’observaren seroreversions d’indivus seropositius en M0 per a IgA i IgM per a tots els antígens, en percentatges respectius del 30% i el 24,5%. No obstant, entre la M3 i M6 no s’observà cap seroreversió.

Pel que fa a la professions hospitalàries, metges i psicòlegs mostren un 50% menys de risc d’infecció que infermeres i auxiliars. De les infeccions produïdes en la cohort d’estudi, el 69% foren simptomàtiques, i en un cas calgué fins i tot hospitalització.

Les dades de 76 participants simptomàtics

Amb 235 mostres de 76 participants simptomàtics, Ortega et al. estudien la cinètica d’anticossos anti-SARS-CoV-2 en relació al dia d’aparició dels primers símptomes. La cinètica és semblant tant en els casos simptomàtics com en els asimptomàtics.

Les IgA i IgM fan un pic en el primer mes posterior a l’aparició dels primers símptomes. El pic d’IgG es produeix al voltant del dia 50. Els nivells IgG contra antígens S (S, S1, S2 i RBD) es mantenen estables, com també ho fan els IgA, fins a 230 dies després de l’aparició dels primers símptomes. De fet, vora el 70% dels participants conservaven la seropositivitat a sis mesos després de l’aparició dels primers símptomes. Els nivells d’IgM, en general, i els nivells d’IgG contra antígens N tendien més clarament al declivi, de manera que a sis mesos tan sols el 34% dels participants retenia la seropositivitat per a IgM, i el 26% per a IgG anti-N.

A partir del dia 150 es registra una tendència a l’augment dels nivells d’anticossos. La cinètica permet distingir entre individus en els quals decau el nivell d’anticossos en les visites M1-M3 i els qui sostenien o augmentaven aquest nivell.

Pel que fa a la capacitat neutralitzant del plasma de persones amb covid-19 simptomàtica, aquesta augmenta fins el dia 80, i roman estable fins més enllà del dia 250.

El rol d’anticossos contra els coronavirus endèmics en la covid-19

En mostres de plasma anteriors a la pandèmia és possible registrar reactivitat d’anticossos contra antígens SARS-CoV-2, i particularment contra la proteïna N. Això s’atribueix a anticossos generats arran d’infeccions amb els coronavirus endèmics. Durant la primera onada, hom suposà que la relativa resistència dels infants a la infecció greu per SARS-CoV-2 era deguda a aquesta immunitat creuada.

Ortega et al. analitzaren els nivells d’anticossos contra antígens N de coronavirus endèmics en 33 participants que s’infectaren de SARS-CoV-2 en el decurs de l’estudi. Val a dir que la seroconversió per SARS-CoV-2 també s’associava a una tendència a l’alça dels nivells d’anticossos contra proteïnes N de coronavirus endèmics, particularment en el cas del 229E.

Un nivell d’IgG anti-229E i anti-NL63 en la M0 s’associava a un menor risc de seroconversió per SARS-CoV-2. De tota manera l’associació més robusta es trobava entre els nivells d’IgA anti-OC43 i la protecció front a covid-19 simptomàtica en el cas d’infectar-se per SARS-CoV-2.

Lligams:

- Seven-month kinetics of SARS-CoV-2 antibodies and role of pre-existing antibodies to human coronaviruses. Natalia Ortega, Marta Ribes, Marta Vidal, Rocío Rubio, Ruth Aguilar, Sarah Williams, Diana Barrios, Selena Alonso, Pablo Hernández-Luis, Robert A. Mitchell, Chenjerai Jairoce, Angeline Cruz, Alfons Jimenez, Rebeca Santano, Susana Méndez, Montserrat Lamoglia, Neus Rosell, Anna Llupià, Laura Puyol, Jordi Chi, Natalia Rodrigo Melero, Daniel Parras, Pau Serra, Edwards Pradenas, Benjamin Trinité, Julià Blanco, Alfredo Mayor, Sonia Barroso, Pilar Varela, Anna Vilella, Antoni Trilla, Pere Santamaria, Carlo Carolis, Marta Tortajada, Luis Izquierdo, Ana Angulo, Pablo Engel, Alberto L. García-Basteiro, Gemma Moncunill & Carlota Dobaño. Nature Communications 12: 4740 (2021).

- SeroCov-1, a la pàgina d’ISGlobal.