dilluns, 11 d’octubre de 2021

Causalitat i treball (Card, Angrist, Imbens; Premi Nobel d'Economia, 2021)

Econometria: La Reial Acadèmia Sueca de Ciències ha comunicat la concessió del Premi Sveriges Riksbank en Ciències Econòmiques en Memòria d'Alfred Nobel. El Premi es dividirà en dues meitats. La primera meitat ha estat atorgada a David Card "per les seves contribucions empíriques a l'economia laboral". La segona meitat correspon a Joshua D. Angrist i Guido W. Imbens "per les llurs contribucions metodològiques a l'anàlisi de relacions causals".

David Card

David Edward Card (*Canadà, 1956) es graduà a la Queen's University (1978). Es doctorà en economia a la Universitat de Princeton (1983) amb la tesi "Indexation in long term labor contracts", supervisada per Orley Ashenfelter. Fou professor ajudant d'economia empresarial a la Graduate School of Business de la University of Chicago (1982-1983). El 1983 retornà a Princeton com a professor d'economia, d'on passà en el 1997 a Berkeley. Fou editor associat del Journal of Labor Economics (1988-1992) i co-editor d'Econometrica (1993-1997) i de The American Economic Review (2002-2005).

Joshua D. Angrist

Joshua David Angrist (*Columbus, Ohio, 18.9.1960) cresqué a Pittsburgh (Pennsylvania) i es graduà en economia a l'Oberlin College (1982). Passà a Israel en el 1982, esdevenint-hi ciutadà. El 1985 retornà als Estats Units per estudiar a Princeton, on realitzà un mestratge (1987) i es doctorà (1989) amb una tesi (Econometric Analysis of the Vietnam Era Draft Lottery) supervisada per Orley Ashenfelter. Fou després professor ajudant a la Harvard University (1989-1991) i professor a la Universitat Hebrea de Jerusalem a partir del 1991. El 1996 passà a l'Economics Department del MIT, on ocupa des del 2008 la càtedra Ford d'Economia i imparteix classes d'econometria i economia del treball.

Guido W. Imbens

Guido Wilhelmus Imbens (*Països Baixos, 3.9.1963) va estudiar a la Universitat Erasmiana de Rotterdam i a la Brown University, on es doctorà en economia (1991). S'especialitzà en econometria i passà successivament com a professor per la Harvard University, la University of California Los Angeles i la University of California Berkeley. Des del 2012 és professor d'economia de la Stanford Graduate School of Business. És l'editor d'Econometria per al quatrienni 2019-2023.

Aspectes d'economia del treball

Juntament amb Alan B. Krueger, David Card s'ocupà dels efectes que l'augment del salari mínim a New Jersey podria tindre en l'ocupació en les cadenes de menjar ràpid. Amb data d'1 d'abril del 1992, el salari mínim de NJ passà de 4,25$ a 5,05$. Card i Krueger (1994) examinaren 410 restaurants de menjar ràpid de New Jersey i de l'est de Pennsylvania (aquests darrers servien com a "control") abans i després de la pujada. Contràriament a les assumpcions habituals, Card i Krueger no trobaren cap impacte de la pujada del salari mínim en forma de reducció de llocs de treball. Els dos economistes publicaren en el 1997 "Myth and Measurement", on defensaven aquesta aproximació d'estudi de "la diferència en diferències".

Card ha defensat les mesures empíriques per estudiar els efectes sobre el mercat de treball de variables com la immigració, l'educació/formació o la desigualtat. En aquestes recerques sovint compara la situació dels Estats Units amb la del Canadà.

Anàlisis de les relacions causals.

Les recerques d'econometristes com Joshua Angrist, Guido Imbens, Alan Krueger, Victor Lavy, Parag Pathak o Jorn-Steffen Pischke s'orienten a l'anàlisi de relacions causals en l'economia, amb particular èmfasi sobre l'impacte de polítiques educatives, socials, migratòries, regulatòries, etc., sobre el mercat de treball.

Angrist i Krueger (1991) estudiaren l'efecte de l'educació obligatòria sobre l'assistència a classe, i els nivells ulteriors de renda, a través d'una comparació dels alumnes nascuts a començament de l'any i els nascuts a final. Trobaren, amb dades dels census del 1960 i del 1980, que les lleis d'assistència obligatòria a l'escola fan que un 10% dels qui altrament abandonarien l'ensenyament hi restin (Angrist i Krueger, 1992a). Amb l'ús de dades de la loteria de recrutament de l'època de la guerra del Vietnam, feren una estimació dels rendiments econòmics de l'escolarització (Angrist i Krueger, 1992b). En aquests estudis les estimacions es feien a través de variables instrumentals, i calia tindre cura de possibles biaixos (Angrist i Krueger, 1995). Angrist (1995) aplicà aquesta metodologia a l'estudi dels retorns econòmics de l'educació en els territoris ocupats de Cisjordània i de la Franja de Gaza. Angrist i Lavy (1997) trobaren que al Marroc el canvi de la llengua vehicular de l'ensenyament secundari del francès a l'àrab reduí els retorns de l'educació degut a una caiguda en el nivell del francès escrit.

Una assumpció habitual és que l'educació crea externalitats positives, però anàlisis sobre els Estats Units dugueren a Acemoglu i Angrist (2000) a concloure que no eren estatísticament significatives.

Ja en el segle XII, Maimònides havia sostingut que una classe no havia de superar la ratio de 40 alumnes per mestre, i Angrist i Davy (1999) aplicaren un model de variables instrumentals per veure si això era cert a l'escola pública d'Israel per trobar que la reducció de la mida de la classe era efectiva en quart i cinquè curs, però no en tercer. Angrist i Lavy (2001) mostraren que la formació continuada dels mestres d'escoles seculars d'Israel era un mitjà efectiu en termes de cost per millorar el rendiment acadèmic dels alumnes, mentre que no eren tan optimistes sobre la introducció d'ordinadors a l'aula (Angrist i Lavy, 2002). Amb un assaig aleatoritzat a Israel, Angrist i Lavy (2009) constataren que els incentius monetaris per a l'obtenció del certificat d'estudis secundaris per a alumnes de poc rendiment funcionaven en noies però no en nois. Un resultat semblant a aquest obtingueren en alumnes de primer any de carrera de Canadà (Angrist et al., 2009).

Angrist ha liderat experiments naturals aleatoritzats a Colòmbia sobre el disseny de xecs escolars per a l'ensenyament secundari privat a Colòmbia (Angrist et al., 2002) i n'ha comparat els resultats amb les dades registrals (Angrist et al., 2006).

Les interaccions entre els alumnes també són un factor en el rendiment econòmic, de tal manera que el resultat individual es correlaciona altament amb el resultat grupal, però que s'han d'avaluar amb un disseny adequat (Angrist, 2014). Angrist et al. (2004) estudiaren si el programa d'integració escolar Metco de Boston generava aquest tipus d'efectes i trobaren que, en tot cas, eren modestos i efímers. Abdulkadiroğlu et al. (2014) retornaren a la qüestió analitzant escoles de Boston i New York.

Pel que fa a la introducció de tests als professorat com ara Praxis, Angrist i Guryan (2008) constataren que això als Estats Units no conduïa a una elevació de la qualitat docent, per bé que sí dels salaris dels mestre, però tenia com a contrapartida una davallada de la diversitat dels mestres, amb una caiguda particular de la fracció de mestres hispans.

Sobre les charters schools, Angrist et al. (2010) trobaren que la KIPP Lynn Acadmy millorava les puntuacions de matemàtiques del seu alumnat en 0,35 SD i les de llengua anglesa en 0,12 SD, i que el guany era encara major en alumnat amb necessitats educatives especials i/o amb poca fluïdesa en anglès (Angrist et al., 2012). Abdulkadiroğlu et al. (2011) trobaren a Boston que les charter schools milloraven les puntuacions d'alumnes secundàries, cosa que no s'observava en les pilot schools. L'efectivitat de les charter schools es deuria en part a l'estratègia No Excuses i la rellevància que donen a la disciplina, a l'aprenentatge tradicional i a la contractació selectiva de mestres (Angrist et al., 2013)

En la seva tesi doctoral Angrist emprà la guerra del Vietnam com un experiment quasi-natural sobre l'impacte d'ésser veterà de guerra en els ingressos laborals ulteriors. Angrist (1990) calculà que els veterans del Vietnam tenien uns ingressos un 15% inferiors als dels no-veterans. Els subsidis a veterans corregien només parcialment aquesta situació, en augmentar en 1,4 anys el llur període mitjà d'escolarització i en un 6% el nivell d'ingressos (Angrist, 1993). Angrist i Krueger (1994) desmentiren amb dades la idea que els veterans de la Segona Guerra Mundial tenien més ingressos que els qui no havien participat en la guerra. Pel que fa als veterans que havien servit en els anys 1980 aquests mostraven posteriorment un nivell d'ingressos superior als qui no s'havien enrolat en les forces armades, que s'explicava per unes millors taxes d'ocupació i no per uns millors salaris en feines civils (Angrist, 1998). Angrist i Johnson (2000) estudiaren l'impacte laboral de les separacions familiars en veterans de la Guerra del Golf.

Angrist i Evans (2000) avaluaren l'impacte de les reformes sobre avortament dels anys 1970 en els resultats acadèmics i laborals de la població afro-americana: la reducció en la fecunditat adolescent es traduí en uns millors indicadors escolars i salarials.

Acemoglu i Angrist (2001) estimaren que la American with Disabilities Act del 1990 tingué un fort impacte negatiu inicial sobre els nivells d'ocupació dels discapacitats.

Angrist (2002) estudià la relació entre la sex ratio, trobant que quan aquesta és esbiaixada cap al sexe masculí es produeix un augment de la taxa de nupcialitat de la dona i una reducció de la població femenina activa.

Angrist i Kugler (2003) analitzaren l'efecte de polítiques proteccionistes front la immigració sobre la taxa d'ocupació de la població autòctona, i trobaren que la restricció de la flexibilitat del mercat laboral exacerba paradoxalment la pèrdua de llocs de treball entre els autòctons en favors dels immigrants.

Angrist i Kugler (2008) trobaren que la pujada de preu de la coca estimulava el conflicte civil a Colòmbia a través de les oportunitats financeres que aquesta pujada ocasionava en les àrees de cultiu.

En tota aquesta recerca sobre causes i efectes resulta de gran rellevància disposar d'eines economètriques, particularment d'estimacions de variables instrumentals. Per a models d'oferta laboral, Angrist (1991) desenvolupà un estimador de quadrats mínims de dues etapes (2SLS). Imbens i Angrist (1994) desplegaren el concepte d'efectes de tractament mitjà local i eines per identificar-los i estimar-los. Angrist i Imbens (1995) demostraren com utilitzar el 2SLS en l'estimació d'efectes casuals mitjans en models amb una intensitat de tractament variable. Angrist, Imbens i Donald B. Rubin dissenyaren un marc per la inferència causal en situacions on l'assignació a un tractament binari és ignorable (Angrist et al., 1996). Angrist, Imbens i Krueger proposaren nous estimadors per a models sobreidentificats (Angrist et al., 1999). Amb Kathryn Graddy, Angrist i Imbens aplicaren estimadors de variables instruments en models d'equacions simultanis, aplicables a la demanda de peix (Angrist et al., 2000). Angrist (2001) explorà estratègies simples per a models amb resultats binaris i no-negatius. Amb Alberto Abadie, Angrist i Imbens aplicaren estimacions de variables instrumentals sobre l'impacte de la formació subvencionada sobre els ingressos dels receptors d'aquesta formació (Abadie et al., 2003). Angrist (2004) explorà l'aplicació de mètodes de variables instrumentals en poblacions heterogènies. Angrist et al. (2006) mostrà com emprar la regressió de quantils en covariats discrets. Per Angrist i Pischke (2010) les millores en el disseny de recerca ha estat clau per aportar credibilitat a l'economia empírica.

Lligams:

- Pressmeddelande: Ekonomipriset 2021.

- Pàgina web de David Card a la UC Berkeley.

- Pàgina web de Joshua Angrist a MIT Economics.

- Pàgina de Guido W. Imbens a la Stanford Graduate School of Business.

- Identification and Estimation of Local Average Treatment Effects. Guido W. Imbens, Joshua D. Angrist. Econometrica 62: 467-475 (1994).

- Minimum Wages and Employment: A Case Study of the Fast-Food Industry in New Jersey and Pennsylvania. David Card, Alan B. Krueger. The American Economic Review 84: 772-793 (1994).

- Split-Sample Instrumental Variables Estimates of the Return to Schooling. Joshua D. Angrist, Alan B. Krueger. Journal of Business & Economic Statistics 13: 225-235 (1995).

dissabte, 9 d’octubre de 2021

Un antic sistema deltaic al cràter de Jezero visitat per la NASA Perseverance

Paleohidrologia marciana: Si el cràter Jezero fou triat com a objectiu per a la missió NASA Perseverance fou pel seu aspecte d'antic llac (el mot Jezero vol dir llac en serbocroata). Les imatges des dels satèl·lits artificials marcians indicaven a l'oest del cràter, en connexió amb la Vall del Neretva (un altre referent toponímic serbocroata en terres marcianes), una formació sedimentària en forma de bànol que recordava justament una formació deltaica. Des del febrer del 2021, la NASA Perseverance és en el terreny, i N. Mangold et al. presenten aquesta setmana un article a la revista Science en el qual analitzen imatges preses per aquest ròver en els primers tres mesos de la missió. La missió des del sòl permet accedir a estrats invisibles des de l'òrbita marciana, que indiquen efectivament que es tracta d'una formació deltaica, amb avançament cap al llac de sediments. Si els estrats més profunds s'haurien acumulat en un procés hidrològic gradual, els estrats superiors s'haurien dipositat arran d'inundacions episòdiques puntuals molt més enèrgiques. Així és com queda registrada la transició d'una situació d'activitat hidrològica en un ambient lacustre persistent a una marcada per intensos fluxos fluvials de curta durada.

Mapa del paleollac de Jezero a Mart en temps de la deposició del sediment Kodiak. L'estimació de Mangold et al. de l'abast del llac és inferior a la de Goudge et al. (2015)

Paleohidrologia marciana

Mart és ara un planeta fred i hiperàrid, sense aigua líquida estable en la seva superfície (per raons de temperatura i de pressió atmosfèriques). Però les imatges que satèl·lits i ròvers ens envien indiquen un planeta més càlid i més humit en el passat: hi ha xarxes de valls, bànols sedimentaris, antics llacs fluvials.

En el cràter Jezero trobem dues formacions d'aspecte deltaic, una a l'oest i una altra al nord. Hom suposa que daten de fa 3600-3800 milions d'anys, en la transició entre el Noaquià tardà i l'Hesperià primerenc.

Kodiak

Estratigrafia del turó Kodiak

El turó Kodiak és allò que els geòlegs anomenen un "butte", un turó aïllat amb un cim aplanat. Es troba a un 1 km al sud del principal dipòsit deltaic. Mangold et al. el consideren un romanent d'un dipòsit abans més extens. Processos erosius haurien aïllat Kodiak. L'erosió, d'altra banda, permet fer una estratigrafia dels sediments que integren Kodiak. En total s'hi distingeixen cinc cossos estratigràfics de baix a dalt:
- k1 té un gruix de 17 metres i una extensió horitzontal de 70. Es tractaria d'un gres amb còdols escampats.
- k2 té un gruix de 3 metres.
- k3 té un gruix de 13 metres. La part de baix consistiria en gres o fangolita, amb còdols o blocs aïllats (els més grans dels quals fan 40 cm de diàmetre).
- k4 té un gruix de 10 metres.
- k5 trunca erosivament k4. Consisteix en conglomerats desordenats, amb blocs que fan fins a 1,5 metres de llargada.

Les unitats k1-k4 rpresentaria una deposició deltaica en pendent, amb formació de dunes. La presència de còdols i blocs en aquestes unitats descartaria que fossin dunes merament eòliques. Tot sembla indicar que es formaren en el context d'un delta lacustre, exposat a nivells fluctuants d'aigua.

En l'època de formació de Kodiak, el cràter Jezero contenia un llac tancat i amb una tendència secular a davallar de nivell.

El delta occidental de Jezero

El límit escarpat de l'antic delta occidental de Jezero

Les imatges de NASA Perseveran del front erosiu de la cara sud-oriental de l'antic delta occidental de Jezero indiquen tres cossos sedimentaris:
- a1: presenta un gruix de 7 metres, integrat per estrats tabulars de 10-30 cm de gruix cadascun
- a2: té un gruix que va d'1 metre en la zona nord a 9 metres en la zona sud. Consisteix en conglomerats desordenats de còdols i blocs.
- a3: té un gruix de fins a 10 metres. Conté còdols i blocs més fins que a2.

L'evolució hidrològica de Jezero

El llac marcià del cràter Jezero era un sistema tancat, sense sortides, però amb entrades. En aquestes entrades s'hi formaven dipòsits deltaics. El nivell d'aigua fluctuà durant tot el període, però cap al final aquestes fluctuacions es feren més notables. Al final del període la vida del llac era marcada per episodis d'inundació d'intensitat variable, que queden representats per les unitats a2 i k5. El cabal transportat per Neretva Vallis durant aquestes inundacions anava de 70 a 3.000 metres cúbics per segon. Quines eren les causes d'aquestes inundacions? Mangold et al. postulen pluges intenses, episodis de fosa de neu (arran d'escalfaments vulcànics o per impacte d'asteroides, etc.) o descàrregues procedents de glaceres.

Lligams:

- Perseverance rover reveals an ancient delta-lake system and flood deposits at Jezero crater, Mars. N. Mangold, S. Gupta, O. Gasnault, G. Dromart, J. D. Tarnas, S. F. Sholes, B. Horgan, C. Quantin-Nataf, A. J. Brown, S. Le Mouélic, R. A. Yingst, J. F. Bell, O. Beyssac, T. Bosak, F. Calef III, B. L. Ehlmann, K. A. Farley, J. P. Grotzinger, K. Hickman-Lewis, S. Holm-Alwmark, L. C. Kah, J. Martinez-Frias, S. M. McLennan, S. Maurice, J. I. Nuñez, A. M. Ollila, P. Pilleri, J. W. Rice Jr, M. Rice, J. I. Simon, D. L. Shuster, K. M. Stack, V. Z. Sun, A. H. Treiman, B. P. Weiss, R. C. Wiens, A. J. Williams, N. R. Williams, K. H. Williford. Science (2021)

- NASA’s Perseverance Sheds More Light on Jezero Crater’s Watery Past, comunicat de premsa de la NASA

- Pàgina web de MARS 2020 Mission, en el marc de la qual s'hi troba el rover Perseverance.

dimecres, 6 d’octubre de 2021

L'organocatàlisi asimètrica (List, MacMillan; Premi Nobel de Química, 2021)

Química orgànica: La Reial Acadèmia Sueca de Ciències ha anunciat la concessió del Premi Nobel de Química d'enguany a Benjamin List i a David W. C. MacMillan "pel desenvolupament de l'organocatàlisi asimètrica".

Benjamin List

Benjamin List (*Frankfurt am Main, 11.1.1968) es graduà en química a la Universitat Lliure de Berlin. Sota la supervisió de Johann Mulzer realitzà la tesi doctoral a la Universitat Goethe de Frankfurt sobre la síntesi d'una semicorrina de vitamina B-12, que defensà reeixidament el 1997.

La cianocobalamina o vitamina B-12 és un cofactor de la síntesi d'ADN. El cobalt (Co) ocupa el centre d'una corrina. La tesi doctoral de List tractà de l'obtenció de vitamina B-12 en una semicorrina per comptes d'una corrina.

List fou investigador postdoctoral al Department of Molecular Biology del Scripps Research Institute, a La Jolla (California) entre el 1997 i el 1998. Entre el 1999 i el 2003 fou professor ajudant del Scripps. En el 2003 tornà a Alemanya per esdevindre líder del grup de recerca en catàlisi homogènia de l'Institut Max Planck de Recerca del Carbó. Compagina actualment aquest càrrec amb el de professor honorari de química orgànica de la Universitat de Colònia i el d'investigador principal de l'Institut de Disseny i Descoberta de Reacció Química de la Universitat de Hokkaido. És també l'editor en cap de la revista Synlett.

David W. C. MacMillan

David William Cross MacMillan (*Bellshill, 16.3.1968) es graduà en química a la University of Glasgow. El 1990, sota la supervisió de Larry Overman, inicià la tesi doctoral a la University of California at Irvine sobre una nova metodologia de síntesi estereocontrolada de tetrahidrofurans bicíclics, que defensà reeixidament el 1996. Per aconseguir aquesta síntesi fou clau l'aïllament de l'eunicel·lina, un diterpenoïd del corall tou Eunicella stricta.

MacMillan realitzà un postdoctorat al grup de David Evans de la Harvard University, on treballà en el disseny i desenvolupament de complexos de bisoxazolina derivats d'estany (Sn(II)box). El juliol del 1998 instal·là el seu laboratori a la Facultat de Química de la University of California at Berkeley, i el 2000 passà al Departament de Química de Caltech. El setembre del 2006 traslladà el seu laboratori de catàlisi enantioselectiva a Princeton. En el 2010 fou l'editor en cap fundador de Chemical Science, la revista de química genral de la Royal Society of Chemistry.

L'organocatàlisi asimètrica

El carboni central dels aminoàcids és un carboni quiral en el sentit que, d'acord amb la disposició dels quatre substituents, hom pot tindre dues versions de molècula que difereixen com la mà dreta de la mà esquerra. La síntesi química dóna lloc a una barreja ("barreja racèmica") dels dos isòmers (D-aminoàcid i L-aminoàcid), mentre que la síntesi biològica prefereix habitualment els L-aminoàcids. Els isòmers oposats o enantiòmers comparteixen les mateixes característiques químiques, però difereixen en les propietats òptiques.

La catàlisi és l'acceleració de la velocitat d'una reacció química. Quan l'agent catalitzador és una molècula orgànica hom parla d'organocatàlisi. En certa manera, podríem dir que els enzims biològics són catalitzadors orgànics, però el terme se sol reservar per a molècules orgàniques més senzilles. La simplicitat estructurals dels organocatalitzadors en comparació dels enzims fa que normalment, a diferència d'aquests, no discrimin entre els isòmers d'una mateixa substància orgànica. No obstant, l'organocatàlisi asimètrica sí ho pot fer. Els isòmers d'una mateixa substància orgànica comparteixen els mateixos grups funcionals però amb orientacions diferents de quiralitat. En conseqüència, organocatalitzadors quirals poden servir per suplir el rol d'enzims en reaccions químiques on té rellevància la quiralitat.

Ja des del seu període predoctoral, tant List com McMillan, en grups diferents, es dedicaren a l'organocatàlisi asimètrica o catàlisi enantioselectiva.

El grup de recerca de MacMillan ha fet notables contribucions en l'organocatàlisi asimètrica, que s'ha traduït en nous mètodes per la síntesi enantioselctiva d'un ample rang de productes naturals. En el 2000 aconseguiren la primera reacció de Diels-Alder sota organocatàlisi altament enantio selectiva (Ahrendt et al., 2000). En el mateix any aconseguiren la primera cicloaddició 1,3-dipolar amb organocatàlisi enantioselectiva (Jen et al., 2000).

Reacció de Diels-Alder

El grup de recerca de List treballà la catàlisi asimètrica per prolina de reaccions aldòliques (List et al., 2000). Mayer i List (2006) demostraren que la catàlisi enantioselectiva era possible fins i tot quan la quiralitat residia exclusivament en el contranió del catalitzador.

Una sal integrada per un catió amoni aquiral i un contranió fosfat quiral és capaç d catalitzar la transferència asimètrica d'hidrogenacions d'aldehids, com demostraren Sonja Mayer i Benjamin List en el 2006

Ilija i Benjamin (2012) aconseguiren catalitzar una espiroacetalització asimètrica amb àcids Brønsted confinats. Aquest confinament en motius imidofosforimidats també serví al grup de Benjamin en la consecució organocatalitzadors altament actius i altament enantioselectius per a l'al·lilació d'aldehids (Kaib et al., 2016) o per a la protonació d'alquens (Tsuji et al. 2018).

Les dues primeres dècades del segle XXI han estat ben fructíferes per a l'organocatàlisi enantioselectiva, tant per les aportacions dels grups de List i de MacMillan com d'altres equips. Alguns conceptes ja han pogut traslladar-se a processos industrials, particularment en la indústria farmacèutica.

Lligams:

- Pressmeddelande: Nobelpriset i kemi 2021.

- Pàgina de Benjamin List al Max-Planck-Institut für Kohlenforschung.

- Pàgina de The MacMillan Group a Princeton

- Proline-Catalyzed Direct Asymmetric Aldol Reactions. B. List, R. A. Lerner, C. F. Barbas. Journal of the American Chemical Society 122: 2396-2396 (2000).

- New Strategies for Organic Catalysis:  The First Highly Enantioselective Organocatalytic Diels−Alder Reaction. K. A. Ahrendt, C. J. Borths, D. W. C. MacMillan. Journal of the American Chemical Society 122: 4243-4244 (2000).

- New Strategies for Organic Catalysis:  The First Enantioselective Organocatalytic 1,3-Dipolar Cycloaddition. W. S. Jen, J. J. M. Wiener, D. W. C. MacMillan. Journal of the American Chemical Society 122: 9874-9875 (2000).

- Asymmetric Counteranion-Directed Catalysis. S. Mayer, B. List. Angewandte Chemie International Edition 45: 4193-4195 (2006).

dimarts, 5 d’octubre de 2021

Dinàmica de sistemes complexos (Manabe, Hasselmann, Parisi; Premi Nobel de Física 2021)

Física de sistemes: La Reial Acadèmia Sueca de Ciències ha anunciat la concessió del Premi Nobel de Física de l'edició d'enguany. El divideix en dues meitats. La primera meitat és compartida per Syukuro Manabe i Klaus Hasselmann "per la modelació física del clima de la Terra, amb la quantificació de la seua variabilitat i amb una predicció fiable de l'escalfament global". L'altra meitat recau en Giorgio Parisi "per la descoberta del joc entre desordre i fluctuacions en sistemes físics, des de l'escala atòmica a la planetària".

Syukuro Manabe

真鍋 淑郎 (*Ehime, 21.9.1931) es doctorà a la Universitat de Tòkio (1958). Passà seguidament a treballar per a la General Circulation Research Section del U.S. Weather Bureau, on desenvolupà la seva carrera professional fins el 1997. El 1997 tornà a Japó per encapçalar, fins el 2001, la Divisió de Recerca en Escalfament Climàtic del Sistema de Recerca de Canvi Global. El 2002 retornà als Estats Units per col·laborar en el Program in Atmospheric and Oceanic Science de Princeton University, de la qual és el meteoròleg degà.

Klaus Hasselmann

Klaus Hasselmann (*Hamburg, 25.10.1931) passà part de la infantesa a Anglaterra, on s'havia exiliat la seva família (el seu pare era militant de l'SPD) arran de l'ascens al poder de Hitler. Després de la guerra, la família tornà a Hamburg, i ell s'hi graduà en física i matemàtica a la Universitat d'aquesta ciutat. La seva tesi de diplomatura tractà de la turbulència isotròpica. Es doctorà el 1964 a la Universitat de Götingen i a l'Institut Max Planck de Dinàmica de Fluids. Més endavant fou professor titular de geofísica teòrica a l'Institut de Geofísica de la Universitat d'Hamburg. Fou pioner en la introducció dels diagrames de Feynman en les interaccions no-lineals de camps d'ones marines (Hasselmann, 1966). El febrer del 1975 esdevingué el primer director de l'Institut Max Planck de Meteorologia, amb seu a Hamburg, càrrec que servà fins el 1999. Entre el 1988 i el 1999 també fou el director científic del Deutsches Klimarechenzentrum (DKRZ) d'Hamburg. En el 2001 fundà amb Carlo Jaeger el Fòrum Europeu del Clima.

Giorgio Parisi

Giorgio Parisi (*Roma, 4.8.1948) es graduà La Sapienza en el 1970. S'hi doctorà sota la supervisió de Nicola Cabibbo. El 1971 esdevingué investigador al Laboratori Nazionali di Frascati, realitzant estades a la Columbia University (1973-4), a l'Institut des Hautes Études Scientifiques (1976-7) i a l'École Normale Supérieure (1977-8). Participà en aquesta època en aportacions fonamentals a la cromodinàmica quàntica (Altarelli & Parisi, 1977) i en els vidres de spin (Parisi, 1980). El 1981 esdevingué professor de física teòrica a Tor Vergata, i el 1992 professor de teories quàntiques a la Sapienza. Des del 2018 és president de l'Accademia dei Lincei.

La modelització del clima de la Terra

Manabe et al. (1965) foren pioners en la simulació climatològica d'un model de circulació general amb cicle hidrològic. Manabe i Wetherald (1967) desenvoluparen un model de columna atmosfèrica en equilibri radiatiu-convectiu que considerava l'efecte de retroalimentació positiva del vapor d'aigua. Aquest model mostrava com un augment de la concentració atmosfèrica de diòxid de carboni (CO2) comportava un augment de temperatura en la troposfera i una disminució de la temperatura de l'estratosfera. Manabe i Bryan (1969) combinaren un model atmosfèric amb un model oceànic per fer-hi càlculs climàtics. Manabe i Wetherald (1975) utilitzaren un model tridimensional de l'atmosfera per predir l'impacte d'una duplicació dels nivells atmosfèrics de CO2. En els anys 1980 i 1990, el grup de recerca de Manabe aprofundí en la resposta climàtica a l'augment antropogènic de CO2 i d'altres gasos d'efecte hivernacle.

El grup de Manabe treballà inicialment en models de columna atmosfèrica. En els models tridimensional, a aquesta graella vertical s'hi afegeixen una graella horitzonal de latitud i de longitud.

El model de Hasselmann de variabilitat climàtica explica les canvis lents en el clima com la resposta integral a una continuïtat de pertorbacions puntuals i aleatòries (Hasselmann, 1975). D'aquesta forma, la variabilitat meteorològica pot integrar-se en un model climàtic. Hasselmann també realitzà aportacions en la identificació de senyals específics de factors (naturals i antropogènics) que influeixen en el clima.

Desordre i fluctuacions en sistemes físics

En el 1986 Mehran Kardar, Giorgio Parisi i Zhang Yi-Cheng proposaven un model de l'evolució del perfil d'una interfície de creixement (Kardar et al., 1986). L'equació de Kardar-Parisi-Zhang és una equació diferencial parcial estocàstica que permet descriure la dinàmica a diverses escales d'interfícies en creixement. Aquesta i altres aportacions de Parisi han estat aplicades, per ell mateix i per altres grups de recerca, en sistemes ben diversos, des de la dinàmica atòmica de vidres fins a la formació de planetes, passant per estols d'aus.

En contrast amb un ferromagnet (a sota), un vidre d'espín és un estat magnètic caracteritzat per l'aleatorietat d'orientacions. Els treballs de Parisi i d'altres membres de "Cracking the Glass Problem" volen entendre com emergeix el comportament general del vidre a partir del seu caràcter amorf a nivell molecular. El desordre d'espín d'un vidre és sotmès a fluctuacions, ja que l'orientació d'espín de cada partícula és afectada pel de les partícules veïnes.

Lligams:

- Pressmeddelande: Nobelpriset i fysik 2021.

- Simulated climatology of a general circulation model with a hydrologic cycle. S. Manabe, J. Smagorinsky, and R.F. Strickler. Monthly Weather Review, 93(12), 769-798. (1965)

- Thermal Equilibrium of the Atmosphere with a Given Distribution of Relative Humidity. S. Manabe, and R. T. Wetherald. Journal of the Atmospheric Sciences, 24 (3), 241-259. (1967)

- Stochastic climate models Part I. Theory. K. Hasselmann. Tellus 28: 473-485 (1975).

- Dynamic Scaling of Growing Interfaces. M. Kardar, G. Parisi, Y.C. Zhang. Phys. Rev. Lett. 56: 889 (1986).

dilluns, 4 d’octubre de 2021

Receptors tàctils (Julius & Patapoutian, Premi Nobel de Fisiologia, 2021)

Fisiologia sensorial: L'Assemblea Nobel de l'Institut Karolinska ha anunciat la concessió del Premi Nobel de Medicina o Fisiologia de l'edició del 2021 a David Julius i Ardem Patapoutian "per les llurs descobertes de receptors de temperatura i tàctils". S'hi refereixen a proteïnes termosensibles com TRPV1 i TRPM8, i a proteïnes mecanosensibles com PIEZ01 o PIEZ02. Julius identificà TRPV1 com el canal proteic responsable de la percepció de la capsaïcina (el principi actiu de la sensació de cremor del pebre). Patapoutian identificà els receptors Piezo en cèl·lules sensibles a la pressió. Avui sabem que TRPV1 també participa en la nocicepció, i que PIEZ02 és també un proprioceptor.

David Julius

David Julius (*NYC, 4.11.1955) es graduà el 1977 al Massachusetts Institute of Technology (MIT). Sota la supervisió conjunta de Jeremy Thorner i Randy Scheckman realitzà la tesi doctoral sobre convertases de proproteïnes en el decurs de la qual identificà Kex2. Defensà reixidament la tesi doctoral en el 1984, i passà a fer un postdoctorat sota la supervisió de Richard Axel a la Columbia University, on clonà i caracteritzà el receptor 1c de la serotonina (Julius et al., 1988). Més endavant esdevingué professor a la University of California, San Francisco, on establí el seu laboratori de biologia molecular de canals iònics i de transducció sensorial.

Ardem Patapoutian

Արտեմ Փաթափութեան (*Beirut, 1967) estudià a la Universitat Americana de Beirut i, el 1986, passà a la University of California, Los Angeles, on es graduà en biologia cel·lular (1990). Realitzà la tesi doctoral al California Institute of Technology, defensant-la amb èxit en el 1996. Seguidament treballà amb Louis F. Reichhardt a la UCSF, per passar en el 2000 al Scripps Research Institute com a professor ajudant. Compaginà la posició al Scripps amb la investigació per a la Novartis Research Foundation. A partir del 2014 esdevingué addicionalment investigador del Howard Hughes Medical Institute. El laboratori de Patapoutian a Scripps Research se centra en la identificació i caracterització de canals iònics i altres sensors que transdueixen estímuls mecànics (contacte, dolor, so, pressió, etc.) en senyals químics.

Els receptors TRPV1 i TRPM8

En el 1997, el laboratori de Julius clonà i caracteritzà un receptor de capsaïcina, el compost de pebrots del gènere Capsicum que els confereix sabor picant. Caterina et al. trobaren que aquest receptor, TRPV1, present en neurones sensorials, era un canal iònic sensible a la calor dolorosa. Aquest canal pertany a la superfamília de canals catiònics TRP (transient receptor potential).

El grup de Julius també clonà i caracteritzà altres receptors de la mateixa superfamília TRP, com el TRPM8 (=CMR1) o el TRPA1. McKemy et al. (2002) mostraren que el canal TRPM8, present en neurones sensorials del nervi trigemim, s'obria en presència de mentol o a temperatures més fredes. Jordt et al. constataven que el canal TRPA1 de neurones sensorials primàries era sensible a l'oli de mostassa.

El receptor de la capsaïcina fou localitzat en neurones aferents primàries tant somàtiques com viscerals (Tominaga et al., 1998)

Les afinitats químiques d'aquests receptors expliquen en part perquè associem el picant amb la calor i la menta amb la frescor. Aquests tipus de receptors també es troben en les fibres nervioses especialitzades en la detecció d'estímuls dolorosos.

En biologia cel·lular, el concepte de receptor s'aplica a les terminacions neuronals (imatge). En biologia molecular, a les proteïnes, habitualment canals transmembrana, que confereixen aquesta capacitat de recepció a les neurones.

Els receptors Piezo

El laboratori de Patapoutian s'especialitzà en els receptors responsables de la percepció de la temperatura (termoceptors), del tacte i del dolor (nociceptors). A la feina d'identificació de canals iònics i receptors, seguia després l'el·lucidació de la transducció d'aquests senyals (vies de senyalització). Syeda et al. (2015) esclariren l'activació química del canal mecanotransductor Piezo1. Woo et al. (2015) assenyalaren Piezo2 com el principal canal mecanotransductor de la propriocepció (la percepció de posició del cos i de membres corporals). En un model de ratolí, el laboratori de Patapoutian constatà l'expressió de Piezo2 en els extrems sensorials de proprioceptors que inerven els fusos musculars i els òrgans de Golgi de tendons en ratolins.

Syeda et al. (2015) estudiaren el receptor Piezo1 en un model de transfecció en cèl·lules HEK-293T

La identificació dels receptors i dels elements de transducció de la propriocepció i de la nocicepció aporten dianes terapèutiques per a diferents tipus de patologies.

L'òrgan tendinós de Golgi presenta terminacions nervioses amb mecanoceptors Piezo1. És un exemple d'òrgan de propriocepció, ja que ofereix informació sobre pressió o tensió del propi tendó del qual fa part.

Lligams:

- Comunicat de premsa sobre el Premi Nobel de Fisiologia 2021 del Karolinska Institut.

- Julius Lab at UCSF.

- The Patapoutian Lab.

- The capsaicin receptor: a heat-activated ion channel in the pain pathway. Michael J. Caterina, Mark A. Schumacher, Makoto Tominaga, Tobias A. Rosen, Jon D. Levine, David Julius. Nature 389: 816-824 (1997)

- Identification of a cold receptor reveals a general role for TRP channels in thermosensation. David D. McKemy, Werner M. Neuhausser, David Julius. Nature 416: 52-58 (2002).

- Chemical activation of the mechanotransduction channel Piezo1. Ruhma Syeda, Jie Xu, Adrienne E Dubin, Bertrand Coste, Jayanti Mathur, Truc Huynh, Jason Matzen, Jianmin Lao, David C Tully, Ingo H Engels, H Michael Petrassi, Andrew M Schumacher, Mauricio Montal, Michael Bandell, Ardem Patapoutian. eLife 4: e07369 (2015).

- Piezo2 is the principal mechanotransduction channel for proprioception. Seung-Hyun Woo, Viktor Lukacs, Joriene C de Nooij, Dasha Zaytseva, Connor R Criddle, Allain Francisco, Thomas M Jessell, Katherine A Wilkinson, Ardem Patapoutian. Nature Neuroscience 18: 1756-1762 (2015).

dimecres, 29 de setembre de 2021

Què podem esperar del JWST quant a la caracterització atmosfèrica d’exoplanetes?

Exoplanetologia: El proper 18 de desembre hi ha programat el llançament del James Webb Space Telescope (JWST). El JWST succeirà el Hubble Space Telescope (HST) com el més característic dels observatoris astronòmics orbitals. Daria Pidhorodetska, investigadora predoctoral de la University of California at Riverside, és la primera autora d’un article de simulació que vol servir per orientar l’ús de l’HST i del JWST vers la caracterització d’atmosferes de petits planetes. L’article, que apareix a The Astronomical Journal, posa com a banc de proves el sistema planetari de L 98-59, un estel nan M3V al voltant del qual orbiten tres petites planetes (en el sentit que tenen radis inferiors a 1,6 radis terrestres). Pidhorodetska et al. assenyalen la conveniència d’aquest sistema, per la lluminositat de l’estel L 98-59, i per la seva relativa proximitat (10,6 parsecs). En el seu article, Pidhorodetska fan simulacions d’espectroscòpia de transmissió assumint unes atmosferes planetàries dominades per gas hidrogen (H2), vapor d’aigua (H2O), diòxid de carboni (CO2) i dioxigen (O2). Amb l’HST seria possible detectar en un trànsit la presència de H2O i CH4 en els dos planetes més exteriors, a condició que fos una atmosfera de baix pes molecular mitjà. En el cas del JWST/NIRISS, la detecció de H2O seria accessible fins i tot en atmosferes de pes molecular mitjà més elevat.

Simulació de la detecció de dioxigen i d’ozó en l’atmosfera d’un exoplaneta pel JWST

Els trànsits com a oportunitat per a caracteritzar atmosferes exoplanetàries

La majoria dels milers d’exoplanetes coneguts s’han detectat a través del mètode de trànsit, és a dir que s’infereix l’existència d’un planeta per la caiguda periòdica de la lluminositat de l’estel corresponent com a conseqüència del pas del planeta per damunt del disc estel·lar des de la perspectiva de la Terra. Les missions Kepler i K2 han estat especialment fructíferes, però també cal esmentar les aportacions de TRAPPIST-1 o de TESS.

La majoria d’exoplanetes coneguts orbiten al voltant d’estels nans de tipus espectral M, per la senzilla raó que aquest és el tipus més abundant d’estel en l’univers.

En el marc de la missió TESS, es detectà que l’estel catalogat com a L 98-59, situat a uns 10,6 parsecs del nostre Sistema Solar, comptaria, si més no, amb tres planetes. Aquests tres planetes, detectats per TESS mitjançant el mètode de trànsit, han estat confirmats per observacions de telescopis superficials i anàlisis estatístiques.

L 98-59 és un estel de tipus espectral M3V, amb una massa un 31% de la del nostre Sol (i un percentatge similar de radi). La temperatura superficial seria de 3400 K, i s’estima que tindria una antiguitat de més de 1000 milions d’anys.

Dels sistemes multiplanetaris coneguts, únicament HD 219134 és més a prop del nostre Sistema Solar que L 98-59. Els tres planetes identificats tenen períodes orbitals de 2,25; 3,69 i 7,45 dies. D’acord amb els estudis de velocitat radial fets amb el HARPS, L 98-59 c tindria una massa 2,42 vegades la de la Terra i L 98-59 d de 2,31. Pel que fa al planeta més interior, L 98-59 b, seria probablement més petit que la Terra.

Els tres planetes coneguts del sistema L 98-59 es trobarien més enllà de la zona d’habitabilitat. Podrien ser anàlegs de Venus.

Diagrama que mostra la relació entre la velocitat d’escapament gravitatori d’un planeta i el flux estel·lar efectiu. Els planetes situats en la part superior esquerra perden completament l’atmosfera, i els de la part inferior dreta la retenen.

Una sèrie de simulacions

Pidhorodetska et al. utilitzen el Planetary Spectrum Generator (PSG) bo i suposant diverses composicions de les atmosferes de L 98-59 b, c i d. Es contemplen escenaris d’efecte hivernacle disparat, de dessecament i de pèrdua d’atmosfera, així com de presència d’aerosols.

L’atmosfera planetària es faria visible a l’instrumental d’HST i de JWST durant cada trànsit.

És interessant veure quines quatre atmosferes consideren Pidhorodetska et al.:
- 1. atmosfera predominantment d’hidrogen (H2).
- 2. atmosfera predominantment de vapor d’aigua (H2O).
- 3. atmosfera resultant d’un efecte hivernacle disparat, amb predomini de CO2.
- 4. atmosfera dessecada rica en O2 d’origen abiòtic.

Els aerosols contemplats poden ésser tolines de l’estil de Titan o núvol d’àcid sulfúric com els de Venus.

La simulació té en compte la sensibilitat i precisió dels instruments de l’HST i del projectat JWST. Com més sensibilitat, menys nombre de trànsits seran necessaris per acumular evidència d’una determinada característica atmosfèrica. Els estudis exoatmosfèrics fets amb l’HST s’han centrat especialment en la línia de vapor d’aigua de 1,4 μm de longitud d’ona.

El treball previst de JWST amb L 98-59

Entre les observacions previstes del JWST hi ha els trànsits de L 98-59, concretament de L 98-59 c (1 trànsit) i L 98-59 d (2 trànsits). Les simulacions de Pidhorodetska et al. ens ajuden a entendre què podem esperar d’aquestes futures observacions. Probablement, una caracterització atmosfèrica requerirà l’acumulació d’observacions corresponents a més de sis trànsits.

Lligams:

- L 98-59: A Benchmark System of Small Planets for Future Atmospheric Characterization. Daria Pidhorodetska, Sarah E. Moran, Edward W. Schwieterman, Thomas Barclay, Thomas J. Fauchez, Nikole K. Lewis, Elisa V. Quintana, Geronimo L. Villanueva, Shawn D. Domagal-Goldman, Joshua E. Schlieder, Emily A. Gilbert, Stephen R. Kane, Veselin B. Kostov. The Astronomical Journal 162: 169 (2021).

dissabte, 11 de setembre de 2021

La comunicació felina, la flora bacteriana dels xiclets i l’obesitat dels polític: Premis Ig Nobel 2021

Aquest dijous s’ha realitzat la cerimònia, virtual, de lliurament dels Premis Ig Nobel 2021. És la segona vegada que la cerimònia té un caràcter virtual. Arribats a la 31a edició, els Premis Ig Nobel ens fan riure (i pensar) sobre la recerca, la societat i la natura.

La comunicació gat-humà (Susanne Schötz, Premi Ig Nobel de Biologia)

Susanne Schötz ha rebut el Premi Ig Nobel “per analitzar variacions en ronroneus, xiscles, xerrameques, trillades, maullades, laments, xiulets, udols, grunyits i altres modes de comunicació gat-humà”.

En efecte, Schötz combina dos dels seus interessos favorits, els gats i la fonètica, en aquesta línia de recerca. Així doncs, en el 2011, en la Conferència Fonetik d’Estocolm, presentava amb Robert Enklund, una anàlisi acústica comparativa del ronroneu de quatre gats. En l’edició següent, presentava en solitari un estudi pilot de la fonètica de vocalitzacions de tres gats. En l’edició del 2013 de la mateixa conferència, aprofundia en l’estudi fonètic de diferents tipus de vocalitzacions d’aquests tres gats. En el 2014, en el marc de la 7ª Conferència Internacional de Prosòdia de la Parla, presentava amb Joost van de Wejter, un estudi sobre la percepció humana de l’entonació de miols de gats domèstics. En la Fonetik 2016, amb Eklund i Van de Weijer, resumien les aportacions del projecte Meowsic, dedicat a estudiar la melodia en la comunicació humà-gat.

La fonòloga Schötz recollí el premi en la cerimònia virtual de dijous.

El bacterioma dels xiclets mastegats (Leila Satari, Alba Guillén, Àngela Vidal-Verdú, Manuel Porcar; Premi Ig Nobel d’Ecologia)

Leila Satari, Alba Guillén, Àngela Vidal-Verdú i Manuel Porcar han rebut el Premi Ig Nobel d’Ecologia “per emprar l’anàlisi genètica per a identificar les diferències espècies de bacteris que resideixen en les pasterades de xiclet mastegat enganxades en els paviments de diversos països”.

En efecte, aquests investigadors de l’Institut de Biologia Integrativa de Sistemes (I2SysBio) de la Universitat de València i del CSIC, amb seu a Paterna, recolliren xiclets enganxats en el paviment que envolta el Parc Científic de la Universitat de València, així com a localitzacions de París (inclòs Eurodisney), les Σπέτσες, Istanbul i Singapur. A més, seguiren l’evolució del bacterioma durant tres mesos d’exposició a l’ambient extern de xiclets mastegats. D’aquests espècimens establiren una col·lecció de soques bacterianes, en les que estudiaren la capacitat de biodegradació de diferents ingredients dels xiclets. En un article a Scientific Reports constataven que la microbiota oral (Streptococcus spp, Corynebacterium spp.) present en els xiclets mastegats es veu desplaçada en qüestió de setmanes per una microbiota ambiental (Acinetobacter spp., Sphingomonas spp., Pseudomonas spp.). Pel que fa als xiclets de diferents localitats del món comparteixen un bacterioma semblant (Sphingomonas, Kocuria, Deinococcus, Blastococcus) però diferenciable.

La recerca de Satari et al. pot semblar un poca-soltada, i per això els han donat el Premi Ig Nobel, però el cert és que el coneixement del bacterioma dels xiclets té aplicacions en medicina forense. Ells també pensaven en la utilització en el monitoratge de malalties contagioses. Finalment, els microorganismes d’aquest ambient poden tenir aplicacions en el tractament de residus.

Satari, Guillén, Vidal-Verdú i Porcar eren presents en la cerimònia virtual on reberen el guardó.

L’olor de la por en les sales de cinema (Jörg Wicker, Nicolas Krauter, Bettina Derstroff, Christof Stönner, Efstratios Bourtsoukidis, Achim Edtbauer, Jochen Wulf, Thomas Klüpfel, Stefan Kramer, Jonathan Williams; Premi Ig Nobel de Química)

Jörg Wicker, Nicolas Krauter, Bettina Derstroff, Christof Stönner, Efstratios Bourtsoukidis, Achim Edtbauer, Jochen Wulf, Thomas Klüpfel, Stefan Kramer, i Jonathan Williams han rebut el Premi Ig Nobel de Química “per analitzar química l’aire dins de sales de cinema per comprovar si les olors produïdes per una audiència indiquen fiablement els nivell de violència, sexe, comportament antisocial, ús de drogues i llenguatge groller en la pel·lícula que veu l’audiència”.

L’agost del 2015, Jörg Wicker, Nicolas Krauter, Bettina Derstoff, Christof Stönner, Efstratios Bourtsoukidi, Thomas Klüpfel, Jonathan Williams i Stefan Kramer presentaren una comunicació en la Conferència Internacional SIGKDD sobre Descoberta de Coneixement i Mineria de Dades en la que proposaven l’ús de l’exhalació de compostos orgànics volàtils (VOCs) en el monitoratge de la resposta humana a estímuls emocionals. Aquests VOCs es poden detectar en l’aire que envolta aquests subjectes. Wicker et al. prenien com a espai experimental una sala de cinema, amb la intenció de comprovar la relació entre el perfil de VOCs i el contingut semàntic de la pel·lícula projectada. Ho van fer durant un mes, prenent dades de VOCs en intervals de 30 segons, i casant-les amb el contingut del film projectat. Construïren models de predicció i de causalitat, constantant que és possible fer-ne prediccions de baix error basades en una relació causal.

Corbes de predicció per a dos films, un per a tots els públics (“Help I’ve shrunk my teacher”) i un per a major de 12 anys (“I’m off then”).

Stönner, Achim Edtbauer, Destroff, Bourtskoukidis, Klüpfel, Wicker i Williams publicaven en octubre del 2018 un article a PLoS One amb la prova de concepte sobre un mètode de classificació de films per edat d’acord amb els compostos orgànics volàtils humans emesos en projeccions en sales de cinema. La majoria dels compostos no eren capaços de predir tots els factors que entren en la classificació d’edat (aparicions de violència, sexe, comportament antisocial, ús de drogues, llenguatge barroer). Això es deuria al fet que aquests compostos, emesos en l’alè i a través de la pell, s’associen més aviat a respostes biològiques viscerals una mica més senzilles. No obstant, Stönner et al. constataven que l’isoprè si era un bon predictor de la classificació de films per edat, segurament perquè l’emissió es relaciona amb nivells d’agitació muscular.

Wicker, Krauter, Derstroff, Stönner, Bourtsoukidis, Edtbauer, Wulf, Klüpfel, Kramer i Williams recolliren el guardó en la cerimònia virtual.

Obesitat de polítics i corrupció post-soviètica (Pavlo Blavastkyy, Premi Ig Nobel d’Economia)

Pavlo Blavatskyy ha rebut el Premi Ig Nobel d’Economia “per descobrir que l’obesitat dels polítics d’un país pot ser un bon indicador de la corrupció d’aquell país”.

Blavatskyy és professor titular del Departament de Gestió de Desenvolupament Sostenible de l’Escola de Negocis Montpelhièr. Enguany apareixia un article seu a la revista Economic of Transition and Institutional Change en el que es recolliren 299 imatges frontals del 2017 de ministres dels 15 estats post-soviètics. Amb aquestes imatges es feina una estimació per algoritme del seu índex de massa corporal. La mediana de l’índex de massa corporal dels ministres d’un país presenta una alta correlació amb mesures convencionals de corrupció (les de Transparency International, el Banc Mundial, l’Index of Public Integrity). Ministres grossos, país corrupte.

L’Estònia de la primera ministra Kaja Kallas és l’estat post-soviètic amb millor puntuació de transparència segons el Transparency Index

Blavatskyy recollia en la cerimònia de dijous aquest guardó.

Activitat sexual i descongestió nasal (Olcay Cem Bulut, Dare Oladokun, Burkard Lippert, Ralph Hohenberger; Premi Ig Nobel de Medicina)

Olcay Cem Bulut, Dare Oladokun, Burkard Lippert i Ralph Hohenberger han rebut el Premi Ig Nobel de Medicina “per demostrar que els orgasmes sexuals poden ésser tan efectius com les medicines descongestives en la millora de la respiració nasal”.

Bulut et al. abordaven aquesta qüestió en un article aparegut el mes de juliol en Ear, Nose & Throat Journal. Per tal d’avaluar l’impacte de l’activitat sexual en la respiració nasal, feien una avaluació d’aquesta respiració en cinc moments diferents: 1) abans de l’activitat sexual; 2) immediatament després de l’activitat sexual; 3) a 30 minuts de l’activitat sexual; 4) a 1 hora; 5) a 3 hores. Es feien les mateixes mesures l’endemà després de l’aplicació d’un esprai descongestiu. L’avaluació de la respiració nasal es feia amb un escala anàloga visual i un dispositiu rinomètric portàtil. En l’estudi, realitzat en el 2020, participaren 18 parelles heterosexuals, tots elles formades per treballadors sanitaris o parelles de treballadors sanitaris.

Després de l’activitat sexual, la respiració nasal millorava de manera semblant a administrar-se un esprai nasal. Val a dir, però, que l’efecte del descongestiu nasal perdurava més en el temps. De tota manera, els participants amb obstrucció nasal mostraven una millora de la funció després de l’activitat sexual

Bulut, Oladokun i Hohenberger recolliren el dijous el guardó corresponent.

Barbes contra colps de puny (Ethan Beseris, Steven Naleway, David Carrier; Premi Ig Nobel de Pau)

Ethan Beseris, Steven Naleway i David Carrier han rebut el Premi Ig Nobel de la Pau “per comprovar la hipòtesi que els humans desenvoluparen barbes per protegir-se de colps de puny a la cara”.

Els tres investigadors de Utah són autors d’un article a Integrative Organismal Biology sobre aquesta hipòtesi pugilística del véll facial humà. Aquest és un dels trets que presenta major dimorfisme sexual en Homo sapiens: bigoti i barba han estat percebuts com a indicadors de masculinitat i de domini social, fins el punt que hom ha comparat la barba humana amb la melena del lleó. En tots dos casos, l’excés de pèl ajuda a protegir àrees vitals com la gola i la mandíbula. És simptomàtic, a parer dels autors, que la mandíbula sigui un dels ossos més habitualment fracturats en violència interpersonal. Per tot plegat, hipotetitzen que les barbes protegeixen la pell i els ossos del rostre quan els mascles humans lluiten: la barba ajuda a absorbir i dispersar l’energia d’un impacte directe. En el seu article ens expliquen com comprovaren la seva hipòtesi amb un model de fibra d’epoxi (com a anàleg de l’os), damunt de la qual disposen pell ovina dissecada, que és coberta amb una capa densa de pèl o descoberta: sobre aquest sistema deixen caure un pes i mesuren la força amb una cèl·lula de càrrega. Sense la protecció d’aquesta barba artificial, el sistema rep un 16% més força i absorbeix un 37% d’energia total.

El model experimental de la hipòtesi pugilística

Beseris, Naleway i Carrier participaren en la cerimònia virtual per recollir el guardó.

Com s’eviten les col·lisions de vianants? (Alessandro Corbetta, Jasper Meeusen, Chung-min Lee, Roberto Benzi, Federico Toschi; Premi Ig Nobel de Física)

Alessandro Corbetta, Jasper Meeusen, Chung-min Lee, Roberto Benzi i Federico Toschi han rebut el Premi Ig Nobel de Física “per realitzar experiments per a entendre per què els vianants no col·lideixen constantment amb altres vianants”.

Corbetta et al. publicaven el 2018 un article a Physical Review E en el que modelitzaven interaccions entre vianants. El model es basava en observacions durant sis mesos d’usuaris d’una andana de tren i de les interaccions vianant-vianant que en resulten. L’article, doncs, és anterior a la pandèmia, però ja en aquella època els vianants, en el decurs del seu pas, adaptant el ritme i direcció de les passes per preservar una distància mútua de confort i evitar col·lisions. El model resultant reprodueix la prevenció de col·lisions binàries, tant pel que fa a l’abast llarg, basat en informació visual, com a l’abast curt, basat en el contacte directe.

Els cinc co-autors recollien el dijous el guardó en la cerimònia virtual.

L’autoorganització de les gentades (Hisashi Murakami, Claudio Feliciani, Yuta Nishiyama, Katsuhiro Nishinari; Premi Ig Nobel de Cinètica)

Hishashi Murakami, Claudio Feliciani, Yuta Nishiyama i Katsuhiro Nishinani han rebut el Premi Ig Nobel de Cinètica “per realitzar experiments per a aprendre per què els vianants de vegades col·lideixen amb altres vianants”. És a dir, que el premi fa parella antagònica amb l’anterior.

Murakami et al. publicaven ja en temps pandèmics un article a Science Advances sobre com l’anticipació mútua pot contribuir a l’autoorganització de multituds humanes. En aquesta recerca mostraven el vincle entre l’anticipació individual i l’emergència de patrons. Per exemple, en fluxos bidireccionals de vianants es generen espontàniament fileres unidireccionals. En els seus experiments, Murakami et al. mostren com distraccions visuals, en interferir en la capacitat d’anticipació d’alguns vianants, condueixen a un endarreriment en la formació de patrons col·lectius: en aquestes condicions tant els vianants distrets com els que no tenen dificultats per evitar col·lisions. D’això, Murakami et al. dedueixen que les maniobres d’evitació són normalment un procés cooperatiu, i que l’anticipació mútua entre vianants facilitar una formació eficient de patrons.

En els seus experiments, Murakami et al. utilitzen un corredor de 10 metres de llarg i 3 d’ample. Els cercles blaus indiquen vianants als qui s’assigna una tasca visual que els distreu.

Els quatre coautors de l’estudi recollien el guardó en la cerimònia virtual.

Control de paneroles en submarins (John Mulrennan, Jr., Roger Grothaus, Charles Hammond, Jay Lamdin; Premi Ig Nobel d’Entomologia)

John Mulrennan Jr, Roger Grothaus, Charles Hammond i Jay Lamdin han rebut el Premi Ig Nobel d’Entomologia per un estudi realitzat fa 50 anys sobre un mètode de control de paneroles en submarins.

Mulrennan et al. publicaven el 15 d’octubre del 1971 un article al Journal of Economic Entomology sobre un mètode de control d’aquesta plaga en naus submarines. Concretament, vuit submarins foren tractats amb un aerosol del 6,5% de diclorvos, a un ritme de 12 onzes per cada 10.000 peus cúbics. Tres dels vuit submarins, addicionalment, foren tractats amb un esquer de propoxur. El diclorvos mostrava un efectivitat del 97% en el control de paneroles. El propoxur s’adreçava al control de nimfes que haguessin eclosionat d’ous no afectats pel diclorvos. Els investigadors també prengueren mostres de l’aire dels submarins per avaluar la concentració de diclorvos abans i després de la ventilació.

Recentment, l’USS Connecticut ha estat víctima d’una plaga de xinxes. El control de plagues en submarins té un repte en la ventilació després de l’aplicació dels insecticides.

Després de cinc dècades, els tractaments de desinsectació de submarins han evolucionat, sempre mantenint l’equilibri entre l’eficàcia insecticida i la seguretat per a la tripulació. En tot cas, el dijous Mulrennan recollí el guardó en la cerimònia virtual.

El transport aeri de rinoceronts negres (Robin Radcliffe, Mark Jago, Peter Morkel, Estelle Morkel, Pierre du Preez, Piet Beytell, Birgit Kotting, Bakker Manuel, Jan Hendrik du Preez, Michele Miller, Julia Felippe, Stephen Parry, Robin Gleed; Premi Ig Nobel de Transport)

Robin Radcliffe, Mark Jago, Peter Morkel, Estelle Morkel, Pierre du Preez, Piet Beytell, Birgit Kotting, Bakker Manuel, Jan Hendrik du Preez, Michele Miller, Julia Felippe, Stephen Parry i Robin Gleed han rebut el Premi Ig Nobel de Transport “per determinar experimentalment si és més segur transportar per aire rinoceronts de cap per avall”.

Radcliffe et al. publicaven fa uns mesos al Journal of Wildlife Diseases un article sobre els efectes pulmonars i metabòlics de la suspensió pels peus, en comparació amb la recumbència lateral, en el transport de rinoceronts negres immobilitzats capturats per dards aeris. Els programes de conservació del rinoceront negre (Diceros bicornis) han requerit la captura d’exemplars vius i el seu transport per via aèria. Per fer-ho, degudament anestesiats, són lligats pels peus a un helicòpter i transportats cap per avall. La imatge és espectacular, i és raonable que hom pensi que això pot tindre conseqüències negatives en comparació amb un transport amb el rinoceront tombat lateralment. A més, un tractament amb etorfina pot conduir a un hipermetabolisme, amb un requeriment superior de consum d’oxigen i una major producció de diòxid de carboni. Radcliffe et al. forneixen dades corresponents a dotze rinoceronts negres, nou mascles i tres femelles, d’edats entre 8 i 25 anys, i masses corporals de 804 a 1234 kg. Aquests animals foren immobilitzats per dard aeri amb etorfina i azaperona. Se’ls suspenia bé en posició lateral (6 individus) o agafats pels peus (6 individus) des d’una grua durant 10 minuts, i llavors es prenien mesures metabòliques i respiratòries. Tots els animals desenvolupament hipòxia i hipercàpnia. Així doncs, les dues formes de suspensió tenen efectes fisiològics semblants, i fins a cert punt de menys impacte en el cas del transport cap per avall.

Morkel, Jago, Gleed i Radcliffe participaren en la cerimònia de lliurament del guardó.

diumenge, 5 de setembre de 2021

El Congrés de la Unió Internacional per a la Conservació de la Natura (IUCN) a Marselha

Aquesta setmana, del dia 3 a l’11, Marselha acull el Congrés Mundial de Conservació de la Natura de l’IUCN. Durant aquests vuit dies, més de 1000 participants es trobaran en més de 1300 sessions interactives, i decidiran sobre les més de 100 mocions que s’hi han presentat.

El Congrés acull, en primer terme, l’Assemblea de Membres de la IUCN. Són més de 1300 les organitzacions governamentals, de la societat civil i dels pobles indígenes les que hi participen. Tenen veu i vot sobre qüestions de conservació i de desenvolupament sostenible.

En segon terme, acull el Fòrum, considerat una àgora de coneixement per a la ciència, pràctica i innovació de la conservació i el desenvolupament sostenible. Al Pavelló Chanot de Marselha hi ha programades 600 sessions sobre aspectes econòmics, socials, científics i tècnics de temes que abasten la flora, la fauna, els oceans, les àrees protegides, l’economia sostenible, el canvi climàtic o els drets humans.

En tercer terme, és també una Fira de Mostres, amb pavellons i actes públics.

La pandèmia de covid-19 ha fet que el Congrés Mundial de la IUCN s’endarrerís un any. El nombre de participants a Marselha és deu vegades inferior al del Congrés anterior, celebrat a Hawaii el 2016.

Un dels aspectes més coneguts de la IUCN és la llista vermella d'espècies amenaçades. La Llista Vermella inclou a hores d'ara 138.374 espècies amenaçades, de les quals 38.543 es troben en perill d'extinció. La Llista inclou diferents nivells d'amenaçada, i val a dir que normalment les reclassificacions es fan de mal en pitjor. Una excepció de la revisió de la Llista fou comentada ahir per Bruno Oberle, director general de la IUCN: quatre espècies de tonyina ha millorat de perspectiva gràcies a mesures com a quotes de pesca o el combat contra la pesca furtiva. Així, Thunnus thynnus ha passat d'espècie en perill a espècie de menor preocupació; Thunnus maccoyii ha passat de en perill crític a perill simple; i Thunnus alalunga i Thunnus albacares de gairebé amenaçades a menor preocupació.

Un dels reptes de la Llista IUCN és que sigui ben exhaustiva, la qual cosa demana un millor coneixement de les poblacions. Per exemple, la revisió de la Llista IUCN calcula que el 37% de les espècies de condroicits (taurons i rajades) són en perill d'extinció. Les causes d'això són la sobrepesca (100% de les espècies amenaçades), la pèrdua d'hàbitats (31% de les espècies amenaçades) i el canvi climàtic (10% de les espècies amenaçades).

Com s'ha dit, la majoria de revisions de la IUCN van cap a categories pitjors. Així Varanus komodoensis ha passat d'espècie vulnerable a espècie en perill. Les raons d'aquesta reclassificació es relacionen amb l'impacte el canvi climàtic sobre el Parc Nacional de Komodo i de l'illa de Flores: l'ascens del nivell del mar reduiria en un 30% l'hàbitat del drac de Komodo en els propers 45 anys. Altres factors, a més, reduirien addicionalment els hàbits de Flores.

dilluns, 9 d’agost de 2021

La base física del Sisè Report de Valoració Panell Intergovernamental sobre Canvi Climàtic

El Panell Intergovernamental sobre Canvi Climàtic (IPCC) es troba en el procés d’elaboració del Sisè Report de Valoració (AR6), del qual avui s’ha presentat l’aportació del Primer Grup de Treball, corresponent a la base de ciència física. Aquesta contribució vol presentar quina és la comprensió física actual del sistema climàtic i del canvi climàtic, combinant els avenços realitzats en climatologia amb les evidències paleoclimàtiques, les observacions actuals i les simulacions climàtiques globals i regionals. Aquesta aportació ha estat aprovada en la 14ª Sessió del Primer Grup de Treball i la 54ª Sessió de l’IPCC que s’han celebrat aquests dies a Ginebra.

L’estat actual del clima

El report considera inequívoc que la influència humana ha escalfat l’atmosfera, l’oceà i la terra, alhora que canvis amplis i ràpids han tingut lloc en l’atmosfera, l’oceà, la criosfera i la biosfera. L’augment observat en les concentracions de gasos d’efecte hivernacle des de mitjan segle XVIII és causat inequívocament per activitats humanes. En el decurs de la darrera dècada s’han arribat a mitjanes anuals de 410 ppm per al diòxid de carboni (CO2), de 1,866 ppm per al metà (CH4) i de 0,332 ppm per l’òxid nitrós (N2O). Terra i oceà han absorbit vora un 56% de les emissions antropogèniques anuals de CO2 en el decurs de les darreres sis dècades.

L’escalfament es manifesta en el fet que les dues primeres dècades del segle XX han estat, en termes de temperatura superficial global, 0,99 K per damunt del nivell de la segona meitat del segle XIX. Les temperatures continentals han augmentat més que les oceàniques. Aquest escalfament és mediat per les emissions antropogèniques de gasos d’efecte hivernacle, davant del qual l’efecte de refredament dels aerosols antropogènics és menystenible, i encara més ho són les causes naturals de variabilitat climàtica.

El report també constata que és probable que la precipitació sobre els continents ha augmentat des del 1950, i de manera accelerada des els anys 1980. Els cursos de les tempestes de latituds mitjanes s’han desplaçat en direcció cap als pols.

El report considera que és molt probable que la influència humana sigui el principal motor de la retirada global de glaceres des dels anys 1990.

Les emissions antropogèniques de CO2 són el principal motor de l’actual acidificació global de les capes superficials de l’oceà obert.

L’escala dels canvis recents en el sistema climàtic en general no tenen precedents en els darrers segles o mil·lennis. Així doncs, els nivells atmosfèrics de CO2 són els més alts dels darrers 2 milions d’anys. L’augment de la temperatura superficial global en els darrers 50 anys ha estat el més ràpid dels darrers dos mil·lennis. L’augment del nivell global del mar és el més elevat dels darrers 3000 anys.

El canvi climàtic antropogènic ja afecta totes les regions del planeta en termes d’extrems meteorològics: ones de calor, fortes precipitacions, sequeres, ciclons tropicals, etc. En general, els extrems càlids s’han fet més freqüents des del 1950, mentre que els extrems freds han vist reduïda la freqüència i la severitat.

Possibles climes de futur

El report contempla cinc escenaris d’emissions d’efecte hivernacle, i els seus resultats a curt termini (2021-2040), mig termini (2041-2060) i llarg termini (2081-2100).

En tots els escenaris contemplats, l’augment de la temperatura superficial global es manté fins a mitjan segle XXI. Si no hi ha una reducció profunda en les emissions de gasos d’efecte hivernacle, l’escalfament global en el curs del segle XXI depassaria el valor de 1,5 K i fins i tot el del 2 K. En l’escenari pitjor, SSP5-8,5, l’escalfament global a final del segle XXI seria de 4,4 K respecte dels valors preindustrials.

El canvi climàtic s’associa amb una intensificació del cicle global de l’aigua, que guanyaria en variabilitat i es manifestaria en una major freqüències d’esdeveniments meteorològics extrems.

Fins i tot si l’escalfament antropogènic es limités a 1,5 K, el nivell global de la mar pujaria de 2-3 metres durant els propers 2000 anys.

L’adaptació al canvi climàtic

En fer planificacions regionals cal entendre l’efecte modulador de factors naturals i de la variabilitat interna sobre els canvis climàtics antropogènics. De tota manera, el report contempla una intensificació de precipitacions extremes i de sequeres. Afebliments de circulacions oceàniques podrien amplificar l’impacte del canvi climàtic global a escala regional.

La mitigació del canvi climàtic

La mitigació de l’escalfament global exigiria arribar a una situació d’emissió neta zero de CO2 i de forta reducció de les emissions altres gasos d’efecte hivernacle.

El report també contempla mesures de retirada antropogènica de CO2 atmosfèric, per bé que recorda que aquesta tecnologia pot tindre també efectes sobre els cicles biogeoquímics i el clima, i afectar la disponibilitat i qualitat de l’aigua, la producció d’aliments i la biodiversitat.

Lligams:

- IPCC AR6 WGI Full Report.

- IPCC WGI Interactive Atlas.

dissabte, 7 d’agost de 2021

miSHERLOCK: una tecnologia CRISPR per al diagnòstic de variants de SARS-CoV-2

Genètica molecular: Lluís Montoliu, del Centro Nacional de Biotecnología (CNB-CSIC) y del CIBERER-ISCIII, de Madrid, es demana en el darrer número de la Revista del Col·legi de Biòlegs de Catalunya què podem esperar de les eines CRISPR durant aquesta pandèmia COVID-19. Ens recorda que ja en el març del 2020, Feng Zhang proposà l’aplicació del seu sistema SHERLOCK, basat en el sistema CRISPR Cas13a en la detecció de còpies genòmiques de SARS-CoV-2 en mostres clíniques. El cas és que durant tots aquests mesos el diagnòstic d’infecció per SARS-CoV-2 (covid-19) s’ha fet fonamentalment a través de tecnologies d’amplificació (RT-PCR i TMA) i de tests d’antígens. Això entranya una dificultat en el seguiment de les variants de SARS-CoV-2, que es fa amb l’ús de tècniques de seqüenciació genètica, aplicades únicament a una petita mostra dels casos positius de covid-19. James J. Collins, del Wyss Institute for Biologically Inspired Engineering de la Harvard Institute, és l’autor corresponsal d’un article a Science Advances, encapçalat per Helena de Puig, Rose A. Lee i Devora Najjara, en el que es presenta una tècnica SHERLOCK d’instrumentació mínima (miSHERLOCK) per al diagnòstic d’infecció de SARS-CoV-2 i de les variants emergents d’aquest virus. Disposar d’una tècnica així possibilitaria identificar en la saliva de cada pacient de covid-19 quina o quines variants de SARS-CoV-2 l’infecten. La saliva és introduïda a la plataforma de diagnòstic sense processar: hi segueix una extracció, purificació i concentració d’ARN viral, amb reaccions d’amplificació i detecció, que són detectades per fluorescència. L’usuari tan sols hi ha de de fer tres accions, i en una hora obté resposta. La plataforma és capaç d’oferir resultats sobre la presència de SARS-CoV-2 i sobre mutacions associades amb les variants 20I (Alfa, V1), 20H (Beta, V2) i 20J (Gamma, V3). La modularitat del sistema permet un fàcil bescanvi d’assaigs per adaptar-se a les necessitats de l’usuari. També compta amb una aplicació de mòbils per a quantificació de resultats, interpretació automatitzada i distribució remota de les dades.

El dispositiu miSHERLOCK

CRISPR i SHERLOCK

Helena de Puig, Rose A. Lee, Devora Najjar i Xiao Tan dissenyaren i realitzaren experiments, analitzaren les dades i redactaren l’article. Luis R. Soekensen, Nicolaas M. Angenent-Mari, Nina M. Donghia, Nicole E. Weckman, Carlos F. Ng, Peter Q. Nguyen, Audrey Ory, Angelo S. Mao, Thomas C. Ferrante, Geoffrey Lansberry, Hani Sallum i James Niemi realitzaren experiments i editaren l’article. James J. Collins dirigí la recerca i edità l’article, del qual és l’autor corresponsal. Cal recordar que Collins és cofundador i director de Sherlock Biosciences, mentre que Weckman és cofundadora i consultora de 52 North Health Ltd. Els autors agraeixen a M. A. English discussions i assessorament. La recerca es finança a través del Paul G. Allen Frontiers Group, el Wyss Institute for Biologically Inspired Engineering, i dels projectes de Puig, Lee, Tao i Angenent-Mari.

El sistema CRISPR/Cas constitueix un element de la immunitat adaptativa de bacteris i, en aquest sentit, es caracteritza per l’especificitat de resposta a seqüències genètiques. Aquesta especificitat fa que hom l’utilitzi en aplicacions d’edició genètica, però encara més dreturer és utilitzar-lo en diagnòstic molecular.

L’acrònim CRISPR fa referència a repeticions palindròmiques breus regularment espaiades en clústers. L’acrònim SHERLOCK es construeix a partir de “specific high-sensitivity enzymatic reporter unlocking”, i aprofita Cas13a (o Cas12a) per detectar seqüències nucleotídiques específiques.

En el decurs de tots aquests mesos, s’han desenvolupat tests basats en SHERLOCK o en DETECTR per al diagnòstic de la infecció de SARS-CoV-2, però el cert és que no poden oferir gaire més d’allò que ofereixen els altres tests (RT-PCR, TMA, tests d’antígens). El repte de diagnòstic rau en la identificació de variants de SARS-CoV-2, i de mutacions com S:N501Y, S:E484K, que ara es fa en centres especialitzats de seqüenciació: hom té doncs dades epidemiològiques de les variants i de les mutacions de SARS-CoV-2, però en la immensa majoria de pacients de covid-19 no hi ha més que la dada del diagnòstic general.

Puig et al. presenten un miSHERLOCK, és a dir una variant de SHERLOCK d’instrumentació mínima, capaç de la detecció universal de SARS-CoV-2 i de les variants Alpha, Beta i Gamma en mostres de saliva en un sistema autocontingut i de baix cost que fa possible utilitzar-lo en centres d’assistència primària. La plataforma utilitza un mètode de captura d’ARN en paper, amb ulterior amplificació in situ i detecció per Cas. El límit de detecció són 1000 còpies genòmiques/mL. Com a mostra clínica utilitza la saliva, i això fa que el sistema hagi d’incorporar una etapa de filtració i concentració. Encara que el sistema únicament considera les mutacions N501Y i E484K, s’hi poden integrar d’altres com la Y144del.

El disseny del sistema

Per garantir la detecció universal de SARS-CoV-2, s’utilitzaren 43.305 seqüències completes obtingudes de NCBI i alineades amb MAFFT. Per a la variant Alfa, s’empraren 50.001 seqüències genòmiques; per a la variant Beta, 577; per a la variant Gamma, 78.

La seqüència de Cas12 gRNA consta d’una regió de mànec (UAAUUUCUACUAAGUGUAGAU), que permet el reconeixement i unió de la proteïna Cas, i d’una regió adjacent a 3’ que defineix l’usuari segons quina ha d’ésser la diana diagnòstica.

Per a l’amplificació RPA es dissenyaren de 10 a 21 encebadors en els dos sentits per cada diana, amb una longitud d’entre 25 i 40 nucleòtids, i que haurien de donar lloc a amplicons de 100 a 200 parells de nucleòtids.

Com a subjectes experimentals s’utilitzaren mostres clíniques desidentificades procedents de la República Dominicana, i obtingudes a través de Boca Biolistics.

També s’utilitzaren mostres clíniques simulades, elaborades a partir de ATCC VR-1986HK, un preparat inactivat per calor de SARS-CoV-2, que eren abocades a aigua o a saliva humana (adquirida a BioIVT).

Utilitzaren els coronavirus endèmics OC43 i 229E, adquirits d’ATCC, en els experiments d’especificitat.

De Twist Bioscience s’adquiriren variants de SARS-CoV-2 Alfa, Beta i Gamma. També es generaren mutacions sintètiques.

Una vegada seleccionats els reactius, s’utilitzà el programari CAD per dissenyar la plataforma. Els components del sistema foren fabricats amb una impressora 3D en resina negra.

L’aplicació mòbil associada a la plataforma fou construïda amb Xcode, C++, Objective-c, OpenCV 3.1 i Swift.

Construïda la plataforma, es validà amb mostres de pacients.

La diana seleccionada: una regió del gen N

La regió 3’ del genoma dels coronavirus és la més interessant per a les tècniques de detecció, ja que apareix en còpies subgenòmiques produïdes en el decurs de la infecció. En aquesta regió trobem el gen N, que codifica per a la nucleocàpside, proteïna del virió que entra en contacte amb el genoma viral. Puig et al. seleccionaren una regió del gen N altament conservada i característiques de SARS-CoV-2.

El sistema SHERLOCK consta de dos components, un dedicat a l’amplificació isotèrmica de la seqüència diana, i l’altre dedicat a la detecció mediada per Cas de l’amplicó. Aquesta amplificació isotèrmica s’aconsegueix amb un sistema de recombinasa i polimerasa (RPA). És definida pel parell d’encebadors emprats i pels ARN guia (gRNAs). Dels 30 gRNA assajats per Puig et al., el millor és idèntic al 90,7% de les 43.000 seqüències genòmiques contemplades de SARS-CoV-2: l’excepció es deu en un 7,4% dels casos a un polimorfisme C>T de la regió 3’, que no seria problema per a la detecció de Cas12a. Dels 100 parells d’encebadors assajats per Puig et al., el millor és idèntic al 97% dels genomes contemplats.

Puig et al. aconsegueixen percentatges més alts i tot per als gRNA i encebadors dissenyats per a la detecció específica de les variants Alfa, Beta i Gamma.

En les proves realitzades el límit de detecció de l’ARN de SARS-CoV-2 dissolt en aigua per part del miSHERLOCK és de 20.000 còpies/mL, amb un temps de reacció de 55 minuts. No hi ha indicis de reactivitat creuada amb els betacoronavirus endèmics OC43 i 229E.

La mutació S:N501Y, que resulta del polimorfisme A23063U és compartida per les variants Alfa, Beta i Gamma. El gRNA i els encebadors seleccionats per Puig et al. són altament específics per a aquesta mutació, per bé que escapen algunes subvariants amb un polimorfisme G>A en la posició +7 de l’encebador.

La mutació S:Y144del, que resulta d’una deleció de 3 nucleòtids, és característica de la variant Alfa, i permet diferenciar-la de les variants Beta i Gamma. El gRNA i encebadors seleccionats per Puig et al. permeten a miSHERLOCK de discriminar clarament la variant Alfa de la variant originària.

La mutació S:E484K, deguda al polimorfisme G23012A, és present a les variants Alfa, Beta i Gamma, i és potser la més rellevant en termes clínics. El gRNA i encebadors seleccionats per Puig et al. permeten discriminar-la.

La simplificació de passes.

El sistema miSHERLOCK s’adreça a usuaris no-especialistes, que l’operaran sobre mostres de pacients en l’atenció primària, en una oficina de farmàcia o inclús en un entorn no-sanitari. Puig et al. han fet un esforç d’enginyeria per simplificar-ne l’operació. Per això han optimitzat tampons, retrotranscriptases i sistemes de fluorescència. Per exemple, l’addició de la ribonucleasa H (enzim que degrada ARN) millora la cinètica de reacció i augmenta la producció de fluorescència del sistema de detecció.

Puig et al. han adaptat el seu sistema a l’anàlisi de saliva, i no pas a hisops nasofaringis o nasals. La saliva, al capdavall, és més fàcil de collir. Ara bé, aquesta saliva ha d’ésser tractada prèviament, ja que les nucleases salivals podrien generar falsos positius en atacar els reportadors fluorescents. Alhora, el tractament ha de disminuir la viscositat de la saliva, i augmentar l’accessibilitat del material genòmic d’aquesta matriu. El tractament de la saliva que fa el miSHERLOCK inactiva les nucleases (amb ditiotreitol i EGTA), lisa les partícules virals presents (a una temperatura de 95°C), i concentra els àcids nucleics resultants en una membrana porosa (de polietersulfona).

El resultat final del tractament de la saliva és la captura d’àcids nucleics. Llavors comença la reacció pròpiament dita, a una temperatura de reacció de 37°C. Si és present l’àcid nucleic diana, hi ha una generació de fluorescència.

El conjunt del dispositiu diagnòstic té un cost de 15 dòlars USA, i cada assaig costaria 6 $, un preu que es deu sobretot als components enzimàtics de les reaccions d’amplificació i detecció.

L’aparell en funcionament

L’usuari introdueix 2 mL de saliva en el col·lector. Seguidament, activa l’escalfador de l’aparell. En 3-6 minuts, es produeix la deposició de l’ARN salival en la membrana. Llavors l’usuari ha de retirar el col·lector i transferir la columna de preparació de mostra a la cambra de reacció. Llavors s’inicia una reacció de 55 minuts, al cap dels quals l’usuari podrà constatar el positiu a través de la visualització de fluorescència sota el transil·luminador.

Una aplicació mòbil ajuda a la quantificació automatitzada i a la interpretació de resultats. Els valors positius i negatius poden ésser enviats a una base de dades en-línia.

El límit de detecció de miSHERLOCK per a la detecció universal de gen N de SARS-CoV-2 és de 1240 còpies genòmiques/mL. Per posar-ho en context, direm que xifres semblants hem assolit en les aigües residuals de l’àrea metropolitana de Barcelona en els pics de la pandèmia. Els límits de detecció són semblants per a la detecció de les mutacions Y144del i E484K, però són superiors en el cas de la detecció de la mutació N501Y (49000 còpies/mL).

Amb l’ús de 27 mostres de pacients de covid-19 i de 21 mostres control, Puig et al. han obtingut per al seu dispositius una sensibilitat del 96% i una especificitat del 95%.

Perspectives d’aplicació en l’actual context

A hores d’ara tothom és conscient de la importància de disposar de dades precises sobre les variants de SARS-CoV-2 presents en cada context geogràfic i social. El dispositiu de Puig et al. té una gran potencialitat per dissenyar múltiplex de mutacions de SARS-CoV-2 que ens donin informació de la variant concreta que infecta cada pacient. El cost de la prova se situaria al voltant dels 11 $ en el cas d’assaig dúplex.

Quin avantatge ofereix conèixer la variant de SARS-CoV-2 que afecta un pacient? De moment, poca, ja que els protocols que se seguirien d’aïllament i de tractament no difereixen d’acord amb les variants. Però és possible que el desenvolupament i aplicació de tractaments serològics sí requereixi d’un coneixement de la variant que infecta cada pacient. En un escenari d’emergència de variants que escapessin als vaccins, disposar de tècniques que permetin augmentar el nombre de mostres utilitzats al seguiment genòmic del SARS-CoV-2 serà essencial. I aquest escenari potser ens espera d’un moment a l’altre.

Lligams:

- Minimally instrumented SHERLOCK (miSHERLOCK) for CRISPR-based point-of-care diagnosis of SARS-CoV-2 and emerging variants. Helena de Puig, Rose A. Lee, Devora Najjar, Xiao Tan, Luis R. Soekensen, Nicolaas M. Angenent-Mari, Nina M. Donghia, Nicole E. Weckman, Audrey Ory, Carlos F. Ng, Peter Q. Nguyen, Angelo S. Mao, Thomas C. Ferrante, Geoffrey Lansberry, Hani Sallum, James Niemi and James J. Collins. Science Advances 7: eabh2944 (2021).